1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NeTakaya
4 years ago
5

TIMERI

Biology
1 answer:
Irina18 [472]4 years ago
7 0

Answer:

vacuole

Explanation:

In plant cells, temporary storage for food enzymes and waste products is provided by the Vacuole

You might be interested in
What is meant by the EA of a reaction? How do enzymes affect the EA and the DG of a reaction?
zepelin [54]

Answer:

Activation energy may be defined as the minimum amount of the energy required to convert the substrate into the product. The higher the activation energy of a reaction, the slower the speed of a reaction.

The enzymes decreases the activation energy of the reaction and increases the effective collision between the substrate. The enzymes does not change the DG (delta G) or free energy of the reaction. The enzymes maintain the equilibrium of the reaction by increasing the equal amount of the forward and backward rate of the reaction.

4 0
3 years ago
Help please! I belive the answer is NOT C because that happens in S phase, so isn't the answer A?​
Leto [7]

Answer:

YEA IT IS a.

Explanation:

7 0
3 years ago
Read 2 more answers
Fireflies emit flashes of light because of chemical reactions, which occur in their abdomens. The rate of the chemical reactions
damaskus [11]

Since the rate of flashing depends on the rate of reaction, it means that fireflies will flash slower during cold weather.

<h3>How does temperature affect rate of reactions?</h3>

Temperature affects the rate of reaction such that reactions are faster at high temperatures and slower at low temperatures.

Thus, since the rate of flashing in fireflies depends on the rate of reaction, cold temperature means that the rate of flashing will be low as compared to warm temperature.

In other words, fireflies will flash lower during cold weather and vice versa.

More on temperature and rate of reactions can be found here: brainly.com/question/16717828

#SPJ1

4 0
2 years ago
The Moon appears to have different shapes at different times during the month.
nikdorinn [45]

Answer:

B

Explanation:

As the moon rotates around the Earth the angle of light given off from the sun changes.

3 0
3 years ago
How do the ocean waters most often provide fresh water for the Earth?
Alona [7]

Answer:

alter precipitation and storm patterns

Explanation:

5 0
3 years ago
Other questions:
  • In your own words, describe chromosomes, genes, and DNA.
    12·1 answer
  • A scientist was observing a specimen under a microscope. He obtained the specimen from pond water. He observed that the specimen
    10·1 answer
  • The organelle that houses enzymes that degrade cellular debris is the
    10·1 answer
  • What is one benefit to a plant living on land to a plant living in water
    14·2 answers
  • How do human have a sense of taste, and why do they need it?
    10·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which of the following is a part of the morphology (structure) of fish?
    15·1 answer
  • Identify the example of a vestigial structure below.
    6·1 answer
  • The author writes, “Gerardo Ceballos, a researcher at the Universidad Nacional Autonoma de Mexico in Mexico City, acknowledged t
    11·1 answer
  • In pea plants, tallness (t) is dominant to shortness (t). what are the predicted percentages of the genotypes of the offspring i
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!