1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gnoma [55]
3 years ago
15

Which of the following is a part of the morphology (structure) of fish?

Biology
1 answer:
nadezda [96]3 years ago
6 0

Answer:

which is the study of how the component parts of fish function together in the living fish.[1] In practice, fish anatomyand fish physiology complement each other, the former dealing with the structure of a fish, its organs or component parts and how they are put together, such as might be observed on the dissecting table or under the microscope, and the latter dealing with how those components function together in living fish.

You might be interested in
What are the steps taken for the conservation of rare animals in nepal​
emmasim [6.3K]

Answer:

the steps are

we need to keep tight security system in forest area

hunting of animal must be stopped

3 0
3 years ago
Which statement about climax community is true?
Svet_ta [14]
The answer to this question is c! Thanks for posting your questions!

6 0
3 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Imagine you do a DNA fingerprinting in a forensics lab. You obtain nine samples from a crime scene and use them to make DNA firn
Nadya [2.5K]
You didn’t attach a picture, when you attach a picture of the fingerprints we can solve the problem!
6 0
3 years ago
Explain the working method of tongue​
melamori03 [73]

Explanation:

Chewing, grinding, pressing, salivating

When we chew, the tongue and the cheeks work together to constantly move the food between the teeth so that it can be chewed. The tongue presses the crushed food against the palate and moves this bolus, which is then ready to be swallowed, to the throat.

3 0
3 years ago
Read 2 more answers
Other questions:
  • What is the minimum dose that results in reddening of the skin?
    6·1 answer
  • Water changes from a liquid to a gas in the process of evaporation
    9·2 answers
  • What is the main function of the cell membran
    11·1 answer
  • The outer layer of a cell that acts as a gatekeeper to a cell is the _____.
    6·2 answers
  • Why does the reduction of the dye DCPIP work best using the chloroplasts whose outer envelopes have been damaged during preparat
    5·1 answer
  • Off which continent did hurricane Katrina originate
    6·1 answer
  • (Help me pls)
    14·1 answer
  • Definition: A thin, flexible, semipermeable barrier around the cell which regulates what enters and leaves
    14·1 answer
  • PLS HELP THE DUE DATE IS TOMORROW AND I CHOOSE AN URBAN CITY
    11·1 answer
  • Does the volume increase with trial number, decrease with trial number, or stay about
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!