1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gelneren [198K]
4 years ago
8

How are the principles of probability used in genetics?

Biology
1 answer:
beks73 [17]4 years ago
5 0
We use principles of probability in genetics through measuring and determining (or atleast trying to determine) the probabilities of certain offspring being born. This is also perhaps the most useful application of probability theory in genetics. 
You might be interested in
20 POINTS! Why is it important to use a controlled experiment?
gregori [183]
Answer is B !!!

you have to know what youre doing
3 0
2 years ago
Read 2 more answers
What's the subphylum of a frog
Nuetrik [128]
<span>Frogs are classified in the phylum chordata subphylum vertebrata, class amphibia, order -Anura.</span>
8 0
3 years ago
Help please I do not understand
Gnoma [55]

Answer:

Atoms in reactants are equal to atoms in products. so it represents law of conservation of energy

4 0
3 years ago
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
Although armand has been in several fierce battles during the war, he awakens on the morning of a planned invasion completely bl
pishuonlain [190]

<span>If Armand has been in several fierce battles during the war, and suddenly awakens on the morning of a planned invasion with complete blindness for which the doctors find no medical cause. The doctors would suspect that Armand has a CONVERSION DISORDER. More so, that he has an unconcerned disposition towards the sudden blindness.</span>

5 0
4 years ago
Other questions:
  • The part of the neuron that receives incoming messages is the _________
    5·2 answers
  • Which processes are involved in the cycling of carbon within the biosphere
    8·1 answer
  • A measure of the amount of body fat a person has as compared to muscle and bone is known as
    8·1 answer
  • How is the concentration of animal bones explained? (movie: surviving africa)?
    12·1 answer
  • What basic life processes must all unicellular organisms<br> perform in order to survive?
    8·1 answer
  • What two conditions must be true for a group of animals to be considered the same species
    14·1 answer
  • In a certain plant species, thick-shelled seeds are caused by the dominant allele T, while thin-shelled seeds are caused by the
    11·1 answer
  • Which theory suggests that the universe continues to look the same throughout, with the old stars and
    15·1 answer
  • What is the term used to describe organisms that capture solar energy and release oxygen as a by-product?
    5·1 answer
  • Where will you find permafrost? tall grass prairie savanna chaparral tundra
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!