1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
meriva
3 years ago
8

To reproduce, female elephants produce eggs and male elephants produce sperm. Offspring are produced by the fusion of an egg wit

h a sperm cell. Which statement is true about the offspring? A. The offspring are genetically distinct from the parents because the egg and sperm are both diploid. B. The offspring are genetically identical to the parents because they are produced by sexual reproduction. C. The offspring are genetically distinct from the parents because they are produced by sexual reproduction. D. The offspring are genetically identical to the parents because the egg and sperm are both diploid.
Biology
2 answers:
Helga [31]3 years ago
6 0

The right answer is C. The offspring are genetically distinct ... by sexual reproduction.

Sexual reproduction, as opposed to asexual reproduction, indicates that the propagation of a species involves male and female gametes. It is the main method of reproduction of multicellular organisms.

In the first stage of sexual reproduction, meiosis, the number of chromosomes is reduced from a diploid number (2n) to a haploid number (n). During fertilization ("fertilization"), haploid gametes come together to form a diploid zygote and restore the initial number of chromosomes (2n).

nlexa [21]3 years ago
5 0

<u>Answer</u>: C. The offspring are genetically distinct from the parents because they are produced by sexual reproduction.

<u>Explanation</u>: <em>Sexual reproduction</em> occurs through the fusion between an egg and a sperm cell. Each of these cells has a single set of chromosomes and thus are haploid. As a result, the offspring will be a diploid organism with half of its genetic material coming from the mother and half from the father.

Because the offspring is a combination of the parental genetic information, its own genetic setup will be thus unique compared with that of each parent.

The type of reproduction in which the offspring is identical to the parent is called <em>asexual reproduction</em>. Here, one organism produces a genetic copy of itself, without  exchanging genetic information with another organism through sex.

You might be interested in
Which of the following applies to skeletal muscle? Select all that apply. A : moves food and substances through the GI tract B :
Nikitich [7]
Skeletal muscle support and Movement. Skeletal muscles move the body. Skeletal muscle contractions pull on tendons, which are attached to bones. If contraction of the muscle causes the muscle to shorten, the bone and, thus, the body part will move. so your answer is D
8 0
3 years ago
Read 2 more answers
Sulfur combines with atmospheric ______ to form sulfuric acid.
JulsSmile [24]
Water vapor , you need a liquid to have acid rain-(rain is water btw) 
3 0
3 years ago
The master gland is the _____, which secretes hormones that stimulate other glands of the body.
zepelin [54]
Pituitary gland is the master gland
8 0
4 years ago
A 1475 kg car with a speed of 66.5 km/h brakes to a stop. How many cal of heat are generated by the brakes as a result?
SpyIntel [72]

Answer:22.180

Explanation:divide the two together then use the first three number after the decimal.

.

8 0
3 years ago
Read 2 more answers
Sapiens is the name of a species. homo is the name of a genus. hominidae is the name of a __________. primate is the name of an
KatRina [158]
Hominidae is the name of a family.
7 0
3 years ago
Read 2 more answers
Other questions:
  • Stored energy is _____.<br> A. potential energy<br> B. kinetic energy<br> C. entropy<br> D. enthalpy
    8·2 answers
  • Which of these organic molecules functions to help speed up biological chemical reactions?
    15·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which of the following are physical properties of matter? A. phase of matter and temperature B. density, solubility, and hardnes
    11·2 answers
  • Chromosome abnormalities may
    10·2 answers
  • What are recessive alleles?
    15·2 answers
  • the purpose of meiosis is to make gametes, also known as sperm and egg cells. in humans, your body cells have 46 chromosomes. ho
    7·1 answer
  • How do organ cultures differ from cell cultures
    14·2 answers
  • 11. What type of cell is formed in this MALE organism at stage D? *
    11·1 answer
  • the six kingdom system was desgined to account for great variation in the kingdom that contained the?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!