1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sertanlavr [38]
3 years ago
5

How are the order of codons determined? The DNA sequence determines the order. The RNA sequence determines the order. The number

of genes determines the order.
Biology
2 answers:
drek231 [11]3 years ago
8 0

Explanation:

-The RNA sequence determines the order.

Nucleic acids are comprised of smaller units called nucleotides and function as storage for the body’s genetic information. These monomers include ribonucleic acid (RNA) or deoxyribonucleic acid (DNA). They differ from other macromolecules since they don’t provide the body with energy. They exist solely to encode and protein synthesis.

<em>Basic makeup: C, H, O, P; they contain phosphate group 5 carbon sugar does nitrogen bases which may contain single to double bond ring.</em>

Codons are three nucleotide bases encoding coding and amino acid or signal at the beginning or end of amino acid synthesis. RNA codons determine certain amino acids so the order in which the bases occur within in the codon sequence designates which amino acid is to be made bus with the four RNA nucleotides (Adenine, Cysteine and Uracil) Up to 64 codons (with 3 as stop codons) determine amino acid synthesis. The stop codons ( UAG UGA UAA) terminate amino acid/ protein synthesis while the start codon AUG Begins protein synthesis

Learn more about transcription at brainly.com/question/11339456

Learn more about DNA and RNA brainly.com/question/2416343?source=aid8411316

#LearnWithBrainly

choli [55]3 years ago
7 0

Answer: the DNA sequence determines the order.

You might be interested in
What are two things that can be done to maximize the chances of recovering parasites from a fecal smear?
RideAnS [48]
<span>Sedimentation - uses solutions of lower specific gravity than the organisms, which concentrated in the sediment. This technique is recommended for general diagnostic laboratories because it is easy to perform and less prone to technical errors.

Flotation - this technique uses solutions of higher specific gravity than the parasitic organisms so the organisms float and the debris sinks producing a cleaner material while the disadvantage is that walls of cysts and eggs collapse that may blocking its identification.<span>
</span></span>
7 0
3 years ago
If a government entity wanted to write regulations that might reduce smog, what human activities might they want to focus on?
Scorpion4ik [409]
Industry
Cars
Fuel burning
Use of chlorofluorocarbons
7 0
2 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
What does a red blood cell look like at in 0.65M solution
Ket [755]
It depends on what kind of solution is referred as 0.65 M. If the solution where the red blood cell is present is hypertonic, the red blood cell will shrink. If the solution is hypotonic, the red blood cell will expand. If the solution is isotonic, the red blood cell will not expand or shrink.  
6 0
3 years ago
Blue poppies native to China were grown at a plant-breeding center in California. The plants with the thickest leaves were most
DIA [1.3K]

Answer:

Directional selection

Explanation:

Directional selection is a type of natural selection that favors one extreme phenotype of a genetic trait due to its survival and reproductive advantage to the individuals over another extreme phenotype and the intermediate phenotype.

In the given example, the thick-leaved plants are better adapted to a drier climate due to reduced water loss. Directional selection favored the plants with thick leaves which in turn produced more progeny. Over the generations, the population evolved into the one having more number of thick-leaved plants.

8 0
3 years ago
Other questions:
  • Kelley used to do three sets of squats one time per week. after three weeks she noticed she was less sore than when she started
    10·1 answer
  • Jamie was born with facial deformities and defects of the limbs, face, and heart. jamie is also below average in intelligence. j
    10·2 answers
  • HELPPP!!!<br> Marking branniest**if correct<br><br> True or false
    11·2 answers
  • A student notes that an individual has attached earlobes, a recessive trait in humans. A cell is taken from this individual, and
    8·1 answer
  • Meningitis is the inflammation of the protective covering of the meninges. Which organs would be affected first by the condition
    5·2 answers
  • Most of the carbon on Earth is stored in the form of
    8·2 answers
  • How many amino acids cannot be made by the body, so they must be obtained in the diet?
    12·1 answer
  • For each sequence of DNA is shown. Write the complementary RNA sequence underneath the letters, thenuse the codon chart to deter
    5·1 answer
  • Matter that is made of only one kind of atom is called what?
    6·2 answers
  • What type of cell is Cell City and what type of cell does Celley come from?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!