1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yKpoI14uk [10]
3 years ago
5

Cual es la rapidez registrada me ayudan porfa ​

Biology
1 answer:
Ilya [14]3 years ago
8 0

Answer:

I hope this answer is correct

Explanation:

Mira en fotografías de alta velocidad cómo un estornudo puede expulsar saliva y moco a más de dos metros. Mucho más allá de las pautas de distanciamiento social establecidas para enfrentar al coronavirus.

You might be interested in
The best way to characterize the role of sherron watkins in the downfall of enron is:
ankoles [38]
The best way to characterize the role of Sherron Watkins in ,the downfall of Enron is she tried to alert Ken Law about the accounting scandal of Enron. Sherron Watkins is an American Former vice president of corporate Development at the Enron Corporation. Watkins testified about her role in the Enron fraud before committees of the U.S.House or Representatives and senate at the beginning of 2002.
5 0
3 years ago
Anyone wanna be my friend and answer a question can ocean waves freeze
lesantik [10]

Answer:

yes ;P

Explanation:

yw

6 0
4 years ago
Read 2 more answers
When allele frequencies change because of genetic drift, you expect _____. A. the average fitness of the population to increase
olchik [2.2K]

Answer:

D- The effect of drift on average fitness is not predictable

Explanation:

Genetic drift is a mechanism causing change in allele frequencies in a population from one generation to another. Genetic drift happens by random sampling and the benefit or harm of the allele is not a factor in deciding which allele stays and which is deviated from.  

A beneficial allele may be lost, and a harmful allele fixed into the next generation.  Genetic drift affects both small and large populations but its effect is more pronounced in small populations.

Since Genetic drift happens by chance and any allele can be selected, the effect of the drift on the fitness of the population cannot be predicted. If a harmful allele is selected, there will be a negative effect on the fitness. On the other hand, if a beneficial allele is selected, there will be a positive effect on the fitness of the population

8 0
3 years ago
Comment on modern method of irrigation​
aliina [53]

Answer:

Modern method of irrigation is Sprinkling, Subirrigation,intrasoil and salt leaching are the principal purposes of surface irrigation

3 0
3 years ago
I need help in class, I have one more to finish! Pls, help me, guys!
Ludmilka [50]

Answer:

If its dna replication: TTCATGCTATGCTACGTGTACGTACCGAT

If its transcription: UUCAYGCYAYGCYACGYGYACGYACCGAU

Explanation:

8 0
3 years ago
Other questions:
  • What is used to measure the density of the earths layers
    10·1 answer
  • Which of the following are among the most common second messengers?
    11·1 answer
  • Kernels of corn or heat it and become popcorn why is this a chemical change the size and color of the corn have changed the kern
    10·2 answers
  • Will give brainliest to who the quickest and correctly
    12·1 answer
  • The cell walls of bacteria are responsible for the shape of the bacteria and the difference in the gram stain reaction.
    12·1 answer
  • Formuleaza in spatiu acordat un enunt in care sa explici de ce algele rosii, desi au talul pluricelular, au fost incluse in regn
    15·1 answer
  • An area of land from which<br>water runs off into rivers,<br>lakes, streams, and oceans​
    11·1 answer
  • Which biomolecule is made of nucleotides and contain your dna
    6·1 answer
  • Chuckwalla is a large herbivorous lizard of the southwestern United States and northwestern Mexico. A scientist discovered varia
    6·1 answer
  • Clarify the role of neuron when one suddenly touch the hot body?​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!