1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Serga [27]
2 years ago
14

if the continents are constantly drifting do you think is possible to feel them move? explain your answer.

Biology
1 answer:
rodikova [14]2 years ago
3 0
It would be impossible to feel them move because they are moving to slow for us to realize it. Well, that is what I think.
You might be interested in
A strawberry plant is an example of a plant that can reproduce through the process of vegetative reproduction. Are the offspring
alexandr402 [8]
The offspring will be genetically identical to the parent because vegetative reproduction is a form of asexual reproduction. Therefore, there is only one parent and the offspring is identical to the parent.
8 0
2 years ago
Read 2 more answers
Explain the different preparations of cocaine and how they are used.
VLD [36.1K]
<span>Cocaine Preparations -Coca leaves --> Coca Paste (60% pure): Not water soluble, so you can't inject it into the bloodstream -- you need an additional chemical step to turn the paste into crystal powder that can be injected or snorted -Coca --> Cocaine Hydrochloride (99% pure): Doesn't hold up very well to heat, so you can't smoke cocaine hydrochloride -Cocaine Hydrochloride (99% pure) --> Free-Base Cocaine or Crack Cocaine: -Reconvert cocaine hydrochloride back to base state by removing hydrochloride from cocaine (that's why it's called free-base cocaine) -Crack cocaine is a crystallized form, mixture of cocaine and baking soda -75% pure -Can be used at lower doses and is much cheaper than cocaine -Can be smoked</span>
7 0
3 years ago
a reaction that hydrolyzes a phosphodiester bond would cleave a dna molecule between a phosphate group and:
Gnoma [55]

Reactions that hydrolyze the phosphodiester bonds split the DNA molecule between the phosphate groups and the hydroxyl groups of the two sugar groups.

In DNA there is a covalent bond through a phosphate group that connects the hydroxyl group (OH) at the 5' position of the pentose sugar and the hydroxyl group at the 3' position of the pentose sugar of the next nucleotide. This covalent bond is called a phosphodiester bond because chemically the phosphate group is in the diester form.

In other words, the phosphodiester bond connects the sugar in one nucleotide to the sugar in the next nucleotide, so this bond simultaneously connects the two consecutive nucleotides to form a polynucleotide chain. If there is an enzyme that catalyzes the hydrolysis of covalent bonds that combine nucleotides, what happens is that the phosphodiester link between deoxyribose sugars will break.

Learn more about the phosphodiester bonds at brainly.com/question/23660733

#SPJ4

6 0
1 year ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
From Earth’s atmosphere, where can the carbon atom go next?
Naddika [18.5K]
The carbon atom can go to the plants on the Land.
4 0
2 years ago
Read 2 more answers
Other questions:
  • Would someone like to help me plz
    11·2 answers
  • • in 1940 matthew and marion stirling found ________ at the site of ________.
    6·1 answer
  • Is oxygen an biotic or abiotic factor?
    8·2 answers
  • Recently, genes have been indentified in angiosperms that are important in preventing pollen from germinating or growing into th
    14·1 answer
  • Which is a closed system.a tree, a human ,a clock , or a car
    5·1 answer
  • Because of the arrangement of carbons electrons it tends to from long ?
    6·1 answer
  • What two forces contribute to the creation of an ocean gyre?
    15·1 answer
  • C) What amino acid is coded for by this sequence before the mutation? Hint: Use the codon table. (1
    12·1 answer
  • Equilibrium is attained when ______
    9·1 answer
  • Quiz please help depends on my grade please more alredy posted
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!