1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
makvit [3.9K]
3 years ago
12

Over time, some organisms have co-evolved so they mutually benefit and depend upon one another. Many plants, for example, have d

eveloped adaptations in order to attract specific animals that can spread their pollen or seeds and ensure the plant's reproductive success. Which of the following is an example of this type of co-evolution? A. A flower develops a musty odor and only opens at night to attract nocturnal bats with a similar odor. B. A flower develops a yellow and blue color, so it can be seen by bees which are attracted to these colors. C. A flower develops a large, flat surface to attract butterflies that prefer to perch as they feed. D. all of these

Biology
2 answers:
N76 [4]3 years ago
7 0

Answer:

D. All of these

Explanation:

Take care!

kompoz [17]3 years ago
5 0

The answer is; D

This is referred to as co-evolution. It involves the reciprocal evolution of 2 species. This kind of evolution can be seen in mutualism (like the choices described above), and also predator-prey, host-parasite relationships. The term co-evolution was coined by Paul R. Ehrlich and Peter H. Raven in 1964.

You might be interested in
The tRNA for GUCAUCGAUCGAUCGGAUGCC
Lapatulllka [165]

Answer:

CAGUAGCUGCUAGCCUACGG

Explanation:

A and U are opposites

C and G are opposites

so you would do the opposite that would correspond.

3 0
3 years ago
Why are decomposers important to the environment?
Simora [160]

Answer:

They provide nutrients for the growth of plants  

Explanation:

When plants and animals die, they become food for decomposers like bacteria, fungi and earthworms. Decomposers or saprotrophs recycle dead plants and animals into chemical nutrients like carbon and nitrogen that are released back into the soil, air and water.  

Good luck on your test

6 0
3 years ago
most known bacteriophages have which type of morphology? group of answer choices siphovirus podovirus myovirus microvirus
Naily [24]

Bacteriophages most frequently have which sort of morphology, when bacterial genes are transmitted from one bacterium to another by a virus.

<h3>What does a bacteriophage look like morphologically?</h3>

The best method for examining the morphology of bacteriophages is electron microscopy. It has a polyhedral head, a short neck and collar, and a straight tail. It is tadpole-shaped. The head is 950 x 650 in size and has a bipyramidal hexagonal form. A membrane (capsid) that is about 35 thick encloses the contents of the head.

<h3>What kind of bacteriophage is most typical?</h3>

Assphages are a large and common family of tailed bacteriophages that are thought to infect bacteria belonging to the phylum Bacteroidales. Members of this viral family have never been isolated in culture and are still poorly understood despite being present in up to 50% of people and accounting for up to 90% of human gut viromes.

To know more about  bacteriophages visit:-

brainly.com/question/29409301

#SPJ4

8 0
1 year ago
Approximately 71% of Earth is covered with salt water. This salt water comprises
statuscvo [17]

Answer:

one global ocean

Explanation:

7 0
3 years ago
7. Shivering is one way to maintain a stable external environment.<br><br> TRUE or FALSE ?​
Inessa05 [86]

Answer:

True!

Explanation:

I hope it helped you!!

8 0
3 years ago
Other questions:
  • The __________ filter drugs out of the bloodstream and convert them to inactive chemicals.
    6·1 answer
  • The nerves that control voluntary responses like those connected to your muscles are part of the _____ nervous system.
    8·2 answers
  • Ling is devising a checklist to predict a female child's reaching puberty early. which is not a question he should include in hi
    11·1 answer
  • Where do rocks melt?
    6·1 answer
  • Please help fast
    10·2 answers
  • Give three reasons why flowers are important in our day life​
    15·2 answers
  • The A1 allele is at a frequency of 0.3 in a population and the A2 allele is at a frequency of 0.7. A1 is dominant. What percent
    12·1 answer
  • Not all countries have adopted air quality regulations as America has. What impact on human health would these countries experie
    11·1 answer
  • Consumer surplus is the area
    12·2 answers
  • CHROMOSOMES AND INHERITANCE VOCABULARY REVIEW Distinguish between the terms in each of the following pairs of terms. X-linked ge
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!