1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
just olya [345]
3 years ago
15

Urgent please answer

Biology
1 answer:
svetlana [45]3 years ago
4 0

Answer:

1) It's called taxonomy

2) There are 7

3) The basic difference between them is Monera are unicellular and prokaryotic cellular structures, whereas Protista are unicellular and eukaryotic cellular structure. Cell organelles are absent in Monera, but Protista is well-defined and has membrane-bound organelles.

4) Reptiles and Fish belong to kingdom Animalia

You might be interested in
Which principle helps to explain the reason behind why the two alleles for a single trait separate from each other when gametes
Misha Larkins [42]
The law of A. <span>segregation </span>is the Mendel’s laws or principles explain that traits are passed from parents to offspring individually instead of as pairs, groups or sets. So the correct option is option “A” as far as the given question is concerned. This is a law or principle which states that during the formation of gametes, two copies of each heredity factors separate out so that the new offspring can get one factor of both the parents. This law was the first law in this direction.

3 0
3 years ago
How are interphase and mitosis different from one another?
seraphim [82]

Answer:

<em>Hi Todoroki here! UwU</em>

Explanation:

The key difference between interphase and mitosis is that interphase is the longest phase of the cell cycle in which cell grows and replicates its DNA while mitosis is a short phase of the cell cycle in which cell nucleus turns into two nuclei that bear identical genome as the original nucleus to produce two new cells.

<em>~Happy to help! ^^</em>

8 0
3 years ago
if humans were wiped out and allowed room for a new dominant species, out of all animals listed which one would have the most po
xxTIMURxx [149]

Answer:

the raven

Explanation:

octopus - intelligent but very antisocial with a short life span, meaning they most likely will not work with other octopuses to improve while also living in the ocean making it harder to build. (but could probably evolve to walk on land)

dolphin - smart but does not have thumbs to make tools and lives in the ocean meaning they have a disadvantage.

raven - intelligent, works with other ravens and sometimes even wolves, and has shown to make tools.

5 0
2 years ago
Read 2 more answers
In which set of reactions is glucose formed?
kirza4 [7]

Answer:

The answer is cellular respiration

5 0
3 years ago
Read 2 more answers
Define interstitial fluid, indicating whether it is inside (intracellular) or outside (extracellular) cells.
zmey [24]

Answer:

Interstitial flood bath and surround the cells; present outside the cell

Explanation:

Intracellular fluid: The solutions which are present inside the cell

Extracellular fluids: The solutions that are present outside the cell

Extracellular fluid consists of plasma, interstitial, and transcellular fluid

Interstitial fluid; The fluid that is present in cells spaces and capillaries. It contains the nutreints that are secreted by capillaries through osmosis and metabolic waste of cells.

4 0
4 years ago
Other questions:
  • What is the difference between a unicellular organism and a multicellular organism
    13·1 answer
  • Which chromosomal change is represented?
    9·1 answer
  • What gas would there be more of on planet Earth if plants stopped photosynthesising​
    13·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Compare and contrast vascular plants and non-vascular plants.
    12·1 answer
  • Why does vultures smell help them? I’m sentience form please
    15·2 answers
  • Are earthquakes predictable? Explain your answer.
    12·2 answers
  • what is the Term for the process in which an object can be identified when only using the sense of touch
    11·1 answer
  • Which Cell structures are seen in prokaryotic and eukaryotic cells
    12·2 answers
  • Patients with muscular dystrophy have decreased voluntary motion, while involuntary motions remain normal. which tissues are aff
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!