<span>I think for the most part, the warmth of the waters determine what lives in them. In warmer coastal waters, you are going to find coral reefs that provide homes to millions of species of fish and micro-organisms.</span>
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer: I am confused maybe add some choices next time please and thank you
Explanation:
When an object<span> is speeding up, the </span>acceleration<span> is in the same direction as the velocity. Thus, this </span>object has<span> a positive </span>acceleration<span>. In Example , the </span>object<span> is moving in the </span>negative<span> direction ( </span>has<span> a </span>negative<span> velocity) and is slowing down.</span>