1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LekaFEV [45]
3 years ago
8

The sickle cell allele is an example of which evolutionary force? how many base changes result in hemoglobin s? in which environ

ment does possessing a sickle cell allele provide an advantage? what is the favored genotype?
Biology
1 answer:
Tamiku [17]3 years ago
7 0
The allele for sickle cell anemia would be an example of natural selection. In most situations, having crescent shaped red blood cells would hold less oxygen & would not be ideal. But in places that are affected by diseases like malaria, which attack red blood cells, having crescent blood cells minimizes the threat malaria can cause.

Hope this helps!
You might be interested in
What conditions account for the development of highly diverse habitats in coastal waters?
kirza4 [7]
<span>I think for the most part, the warmth of the waters determine what lives in them. In warmer coastal waters, you are going to find coral reefs that provide homes to millions of species of fish and micro-organisms.</span>
4 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Which of these is most likely a result of a high
aliya0001 [1]

Answer: I am confused maybe add some choices next time please and thank you

Explanation:

4 0
3 years ago
What is happening to an object when it has negative acceleration?
Allushta [10]
When an object<span> is speeding up, the </span>acceleration<span> is in the same direction as the velocity. Thus, this </span>object has<span> a positive </span>acceleration<span>. In Example , the </span>object<span> is moving in the </span>negative<span> direction ( </span>has<span> a </span>negative<span> velocity) and is slowing down.</span>
3 0
3 years ago
The process of copying a sequence of dna nucleotides into a complementary sequence of rna nucleotides is called
lys-0071 [83]
Called transcription

3 0
3 years ago
Other questions:
  • Heredity refers to the __________.
    9·2 answers
  • What makes gymnosperms especially suited for northern climates?
    7·1 answer
  • How do the structures of the cardiac muscle and skin tissue support their functions within the body? (Hint: Think about
    14·1 answer
  • Calculate the minimum number of nucleotides required in the coding region of the LDS2B mRNA molecule to produce and terminate th
    15·1 answer
  • What condition occurs when hemoglobin is deprived of oxygen?
    12·1 answer
  • The ______ system works with the circulatory system to maintain the correct water balance in cells.
    10·2 answers
  • 6. Which of the following is true about hurricanes? *
    7·1 answer
  • Forest was cleared and turned into a field of soybean plants what occurred to the plants and animals living there
    7·1 answer
  • What do you predict might happen if someone introduced a new species that could eat large amounts of algae at a rapid pace, outc
    14·1 answer
  • Correct Value: 12.75<br> 8.5<br> 8.4<br> 8.4<br> 8.3
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!