1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fofino [41]
3 years ago
12

The speed of a note created by a flute will increase as the speed of sound increases. When a marching band goes outside on a col

d day, what would you predict would happen to the note played on a flute?
A) It would decrease because the speed of sound and temperature are proportional.
B) It would increase because the speed of sound and temperature are proportional.
C) It would decrease because the speed of sound and temperature are inversely proportional.
D) It would increase because the speed of sound and temperature are inversely proportional.
Chemistry
2 answers:
I am Lyosha [343]3 years ago
7 0

Answer:

A.

Explanation:

Ksenya-84 [330]3 years ago
3 0

Answer:

A

Explanation:

I just took the usatestprep

You might be interested in
At 450°C, ammonia gas will decompose according to the following equation: 2 NH3 (g)  N2 (g) + 3 H2 (g) Kc = 4.50 at 475˚C An u
velikii [3]

Answer:

0.2024 M

Explanation:

For the decomposition reactio given, let's do an equilibrium chart. Let's call the initial concentration of NH₃ as C:

2NH₃(g) ⇄ N₂(g) + 3H₂(g)

C 0 0 Initial

-2x +x +3x Reacts (stoichiometry is 1:1:3)

C - 2x x 3x Equilibrium

3x = 0.252

x = 0.084 M

The equilibrium constant (Kc) is the multiplication of the concentrations of the products elevated by their coefficients, divided by the multiplication of reactants concentrations elevated by their coefficients.

Kc = ([H₂]³*[N₂])/([NH₃]²)

4.50 = [(0.252)³*(0.084)]/(C - 2*0.084)²

4.50 = 0.00533/(C - 0.168)²

4.50 = 0.00533/(C² - 0.336C + 0.028224)

4.50C² - 1.512C + 0.127008 = 0.00533

4.50C² - 1.512C + 0.121678 = 0

Solving the equation by a graphic calculator, for C > 0.168

C = 0.2024 M

4 0
3 years ago
Chemical reaction for acrylic fiber (7th grade chemistry) pllllzzzzzz help ASAP.
NNADVOKAT [17]

Answer: The chemical reaction for fiber is that it oxidizes.

6 0
3 years ago
Question 38 (1 point)
Fiesta28 [93]

Answer: Protons because they have a positive charge.

Explanation:

8 0
3 years ago
How many miles are there in 20g of KClO3 (k=39 Cl=35.5 O=16)​
SashulF [63]
<h3>Answer:</h3>

0.144 moles

<h3>Explanation:</h3>
  • The relationship between mass of a compound, number of moles and molar mass of the compound is given by;
  • Number of moles = Mass ÷ Molar mass
  • Molar mass is equivalent to the relative formula mass of the compound that is calculated the atomic masses of the elements making the compound.

In this case;

Our compound, KClO3 will have a molar mass of;

= 39 + 35.5 + 4(16)

= 138.5 g/mol

Mass of KClO3 is 20 g

Therefore;

Number of moles = 20 g ÷ 138.5 g/mol

                            = 0.144 moles

Thus, the number of moles in 20 g of KClO3 is 0.144 moles

4 0
4 years ago
Uv gel enhancements rely on ingredients from the monomer liquid and ________ chemical family.
pishuonlain [190]
<span>UV gel enhancements rely on ingredients from the monomer liquid and polymer powder chemical family. The chemicals from the polymer powder family </span><span>can absorb and retain extremely large amounts of a liquid relative to their own mass. Water-absorbing polymers, </span>can absorb aqueous solutions through hydrogen bonding with water molecules.




6 0
4 years ago
Other questions:
  • There are six kingdoms of living things. Archaebacteria is one of these kingdoms. Which of the following are also kingdoms of li
    13·2 answers
  • Who is credited with creating the first periodic table
    7·1 answer
  • A balloon is floating around outside your window. The temperature outside is -1 ∘C , and the air pressure is 0.700 atm . Your ne
    10·2 answers
  • The acid HOCl (hypochlorous acid) is produced by bubbling chlorine gas through a suspension of solid mercury(II) oxide particles
    15·1 answer
  • Which process is an example of a chemical change?
    11·2 answers
  • The student is now told that the four solids, in no particular order, are calcium bromide (CaBr2), sugar (C6H12O6), butanoic aci
    11·1 answer
  • For the reaction PCl5(g) 4 PCl3(g) 1 Cl2(g) Kp 5 23.6 at 500 K a. Calculate the equilibrium partial pressures of the reactants a
    7·1 answer
  • Put the following elements into five pairs of elements that have similar chemical reactivity: F, Sr, P, Ca, O, Br, Rb, Sb, Li, S
    6·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • An empty vial weighs 55.32 g.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!