1, O because if either shows present it's O.
3 asteroid that hit earth
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
The sister chromatids are then pulled apart by the mitotic spindle which pulls one chromatid to one pole and the other chromatid to the opposite pole.
The chromosomes line up neatly end-to-end along the centre (equator) of the cell.
The centrioles are now at opposite poles of the cell with the mitotic spindle fibres extending from them.
The mitotic spindle fibres attach to each of the sister chromatids.
The DNA in the cell is copied in preparation for cell division, this results in two identical full sets of chromosomes?.
Outside of the nucleus? are two centrosomes, each containing a pair of centrioles, these structures are critical for the process of cell division.
