1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lelu [443]
3 years ago
11

After ingestion of a food particle, pH changes and enzymes contributed by the ________ will digest and hydrolyze the ingested pa

rticle in the phagocytic vacuole.
Biology
1 answer:
harkovskaia [24]3 years ago
7 0

Answer:

as the question is incomplete i have added the link to full question in ask for detail section.

b) Lysosome

Explanation:

After ingestion of a food particle, pH changes and enzymes contributed by the __Lysosome__ will digest and hydrolyze the ingested particle in the phagocytic vacuole.

You might be interested in
What is the purpose of technology?A.Creating political pressureB.Finding new scientific discoveriesC.Regulating the governmentD.
Alchen [17]

Answer:

D, but if feel sorry my second guess will be B

5 0
3 years ago
Choose the definition of: invertebrates
slega [8]
<span>Invertebrates means having no backbone.</span>
7 0
3 years ago
Which statements can be made about mass?
ozzi

Answer:

Weight can be measured in pounds.

A bowling ball has more mass than a basketball.

A bowling ball weighs more than a basketball.

Weight can be measured with a scale.

Objects have the same mass regardless of where they are.

Explanation:

8 0
3 years ago
Read 2 more answers
What is a patent ductus arteriosus? identify two (2) clinical manifestations of patent ductus arteriosus (pda). ati?
Novay_Z [31]
Patent ductus arteriosus occurs when the normal fetal circulation conduit between the pulmonary artery and the aorta fails to close and results in increased pulmonary blood flow. The clinical manifestations of patent ductus arteriosus include; Murmur; wide and bounding pulse pressure, Asymptomatic Heart failure. 
8 0
3 years ago
A nurse is caring for a child with meningococcal meningitis. what clinical finding does the nurse expect to encounter during a p
Katyanochek1 [597]
<span>Answer: "Purpuric skin rash" nurse expect to encounter during a physical assessment.</span>
8 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • The genes for sex-linked traits are carried on either the X or Y chromosome. Duchenne muscular dystrophy (DMD) is a recessive, s
    11·2 answers
  • Two homozygous blue flowers are crossed.<br> How would you solve it?
    9·1 answer
  • Explain the evolutionary relationship between the fin of a fish and the flipper of a whale.
    14·2 answers
  • Blood enters the heart from the arteries.<br><br><br> TrueFalse
    11·1 answer
  • • What does the Human Genome Project decode?
    13·1 answer
  • Identify the wave that has the highest amount of energy​
    10·1 answer
  • Explaining hardy Weinberg equilibrium and the eastern squirrel/ how many in the population have the following genotypes
    6·1 answer
  • Do x rays have longer wave lengths than infrared waves?
    15·1 answer
  • In ivan pavlov’s classic experiments, what type of stimulus was the bell?.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!