1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LekaFEV [45]
3 years ago
6

Please help! i need this due by 12 pm eastern time

Biology
2 answers:
DochEvi [55]3 years ago
8 0

Answer:

the first one i think is d

Mnenie [13.5K]3 years ago
6 0
For the second one maybe D.
You might be interested in
Which factor is most likely to cause the number of rabbits living in an area to increase?
oksian1 [2.3K]
I think some factors that influence rabbit reproduction is enough food, healthy rabbits, lots and lots of space for them to populate, and very little predators. This should help I'm not exactly sure what you are looking for though sorry. :^)
8 0
3 years ago
Read 2 more answers
These statements describe three different reactions.
Arte-miy333 [17]

Answer: 2 - The nucleus of an atom is split apart

Explanation: Any reaction involving the nucleus of an atom is called a nuclear reaction. It is different from ordinary chemical reactions that involve electrons because it involves the release of large amount of energy. Nuclear reactions can be classified as nuclear fission and nuclear fusion.

A nuclear reaction in which a nucleus of an atom is split into two smaller atoms with a release of large amount of energy is called nuclear fission. A nuclear reaction that involves the combination of lighter nuclei of elements to form heavier atoms that are more stable with the release of a large quantity of energy is called nuclear fusion.

5 0
3 years ago
The synaptic knob releases acetylcholine into the synaptic cleft, which is received by receptors on the motor end plate. which s
wlad13 [49]
It portrays the neuromuscular junction of a skeletal muscle. 
The breakdown items are consumed by the pre-synaptic neuron by endocytosis and used to re-combine more neurotransmitter, utilizing vitality from the mitochondria. The Cytoplasm in the Synaptic Knob has a high extent of specific organelles. These incorporate smooth endoplasmic reticulum, mitochondria, and vesicles.
4 0
3 years ago
Healthy bones, teeth, and muscles require the mineral?
Drupady [299]
Calcium is few of the main sources for healthy bones, teeth, and muscles. 

3 0
3 years ago
Read 2 more answers
Which group of plants is MOST adapted to live in regions where the layer of soil beneath the surface stays frozen all the time?
bogdanovich [222]
The answer is <span>C) mosses, lichen, grasses, and small shrubs.

This is because mosses don't have roots and are very simple plants, therefore they don't have to "root" themselves into a permanently frozen ground that can't support them.
</span>
6 0
3 years ago
Other questions:
  • Carbohydrates are important in the body because they contribute to the body's ability to
    8·2 answers
  • Configuracion simplificada de:<br><br>-Mg11 <br><br>-Se34<br><br>-Br35<br><br>PORFA ALGUIEN AYUDEME
    15·1 answer
  • A student half a jar with rice and tightens the jars lid. The student wants to use the jar of rice to model particle motion of a
    15·1 answer
  • Half of the polar bears in a small population die. This population may experience changes due to what
    7·1 answer
  • A group of organ systems that work together to perform a common function
    10·1 answer
  • Can someone explain the 4th dimension to me the best you can?
    10·1 answer
  • Natural selection favors
    6·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • In Mendel's pea plants, green and round peas are dominant to yellow and wrinkled peas. If Mendel
    9·1 answer
  • PLSSSS HELP I REALLY NEED IT PLSSSSSSSS PLSSSS GIVE ME UR THINKING IF U HELPP ILL SEND 60 POINTSS
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!