1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
babunello [35]
3 years ago
5

What is urinary system and what are the organs involved in urine formation. How is urine formed in human body. What is nephron

Biology
1 answer:
Oksana_A [137]3 years ago
3 0

Answer:

The urinary system or the Renal systems regulates or takes out waste from the blood, maintain blood pressure, and controls the ion exchange process.

The parts of urinary system includes:

  • Kidneys
  • Ureters
  • Bladder
  • Urethera

Formation of urine :

When the blood passes through the kidney, it filters the blood. This is a 3 step process:

1) Glomerus filtration: This is the place where formation of urine starts. In glomerus, the water and solute from tiny capillaries and  enter the capsule of the glomerus.

2) The tubular re-absorption: Most of the water and solute gets reabsorbed through this part

3) Tubular secretion: Extracellular fluid molecules get transferred into the nephron, these secretions get discarded out of the body containing mainly creatinine, urea, uric acid, K+ and H+ ions

NEPHRON :

The simplest unit of kidney and its the basic unit that filter the blood. One kidney has approximately 1. 5 million nephrons!

You might be interested in
NEED HELP PLZZ ASAP
Oksanka [162]

Answer:

Make sure everyone meets criteria.

Not taking supplements( As some may contain Vit D)

No tanning beds

make sure no one has a hypoactive response to vitamin d through whatever way. Injection, capsule, spray.

Check for genetic conditions or cancers like melanoma which indirectly affect vitamin d levels

Explanation:

These are some of the main things to look out for

8 0
3 years ago
Define cell conjunctions
tamaranim1 [39]
It means that two or more cells connected together. 
You can look at the word 'cell' and 'conjunctions' separately. 'Cell'  is a tiny particle. 'Conjunctions' means 'two or more things connected', so just put the two meanings together.
Hope this helps. :)
8 0
3 years ago
How do I identify controls, independent and dependent variables
frosja888 [35]

Answer:

what you change vs what you are testing

Explanation:

The independent variable is the variable that you change. For example, if we were growing plants and wanted to see if more sun made them grow higher, you would change the amount of sun that each plant is exposed to.

The dependent variable is what you measure. This depends on the independent variable. So, in our plant experiment, the height of the plant is the dependent variable.

Control. The control is what stays the same. So in our plant experiment, the amount of water, type of plant, type of soil, and all of these things would stay the same to insure that the results are equal.

You affect the independent variable and the control and you test the dependent variable.

5 0
3 years ago
The term ____________________ means the lack of muscle coordination during voluntary movement.
tia_tia [17]

The term <u>Ataxia</u> means the lack of muscle coordination during voluntary movement.

  • Poor muscle control that results in awkward voluntary movements is known as ataxia.
  • It might make it difficult to move your eyes, speak, or walk steadily. It might also make it hard to coordinate your hands.
  • Ataxia is typically caused by injury to the cerebellum, which regulates muscular coordination, or its connections.
  • Ataxia is typically brought on by damage to the cerebellum, a region of the brain, although it can also be brought on by injury to the spinal cord or other nerves.
  • The spinal cord, which extends the length of the spine and connects the brain to every other part of the body, is a lengthy bundle of nerves.

learn more about Ataxia here: brainly.com/question/16031045

#SPJ4

5 0
2 years ago
In one paragraph explain the respiratory system​
Alik [6]
The respiratory system is the network of organs and tissues that help you breathe. It includes your airways, lungs and blood vessels. The muscles that power your lungs are also part of the respiratory system. These parts work together to move oxygen throughout the body and clean out waste gases like carbon dioxide.

Hope this help
3 0
2 years ago
Other questions:
  • This chart shows the annual catch statistics for the red grouper for the state of North Carolina during the 1990’s. Red grouper
    11·2 answers
  • The introductory passage describes ways that virophages use megavirus-producing factories in amoeba to reproduce because they ar
    6·1 answer
  • In the microscope activity, you viewed some of the same specimens under multiple microscopes. Describe the differences in what y
    6·2 answers
  • A scientist has a hunch that students learn best when they write down information with a pencil or pen. He organizes his student
    15·1 answer
  • A plate moves 200 m in 10,000 years. What is its rate in cm/year?
    6·1 answer
  • Long-term memory may involve
    14·2 answers
  • How is DNA describes and what does it mean ?
    8·2 answers
  • Ryan is looking at a cell under a microscope, he observes formation. he observes spindle microtubules from the centrosomes. whic
    10·2 answers
  • "Jasmine is trying to lose weight. She has decided to try a diet that lets her eat unlimited amounts of protein. The protein tha
    10·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!