1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sineoko [7]
3 years ago
6

When a peptide hormone reaches its target cell, which event happens next?

Biology
1 answer:
oksano4ka [1.4K]3 years ago
6 0
<span> They are unable to pass through the plasma membrane and have different methods of action. They attach to their receptors in the target cell surface and influence activity within the cell through cytoplasmic intermediates called second messengers. </span>

<span>The two most important messengers are cAMP and inositol triphosphate. </span>

<span>Cyclic AMP: ATP is converted into cAMP after a series of reactions on the plasma membrane following the attachment of the hormone to the membrane. cAMP relays the signal from the membrane to the metabolic machinery of the cytoplasm. </span>

<span>Inositol Triphosphate: Involves the use of Ca+2 that regulates cellular protein activity.
</span>
Hope this helps !!!^_~!!!
You might be interested in
How do protons contribute towards making ATP?...
ivanzaharov [21]

Answer: Protons contribute towards making ATP by producing proton-motive force that provides energy for ATP synthesis.

Explanation: In the respiratory chain, the transfer of electrons from one complex to another is accompanied by pumping of protons out of the matrix. This creates a difference in proton concentration and separation of charge across the mitochondrial inner membrane. The electrochemical energy inherent in this difference in proton concentration called proton-motive force is used to drive ATP synthesis as protons flow back passively into the matrix through a proton pore.

6 0
4 years ago
Polar bears live in the arctic. the arctic is their select one:
Vadim26 [7]
Option C Habitat.... Polar bears are only found in the Arctic. The most important habitats for polar bears are the edges of pack ice where currents and wind interact, forming a continually melting and refreezing matrix of ice patches and leads (open spaces in the ocean between sea ice).
8 0
4 years ago
Read 2 more answers
Can others, besides athletes, benefit from skill-related fitness? why?
prisoha [69]
<span>Yes, people besides athletes can benefit from skill-related fitness. Skill related fitness training can increase the coordination, reaction time, balance and agility of individuals at large, leading to an increased in ability to complete routine workplace tasks. Accident avoidance can be a benefit to cab drivers with increased reaction times. Wait staff can benefit from increased balance to skillfully carry large trays, Mechanics with good coordination are able to more quickly assemble complex components and in the even of a physical confrontation police officers can benefit from increased agility.</span>
7 0
3 years ago
The various parts of the endomembrane system serve different functions in the cell. In this activity, you will identify the role
liberstina [14]

Answer:

Smooth ER:

Lipid synthesis, Calcium ion storage, Poison detoxification

Rough ER:

Protein synthesis

Golgi apparatus:

Protein modification and storage, Cisternal maturation

Lysosomes:

Autophagy, Macromolecule digestion

Explanation:

The endomembrane system is important for the production, processing, and transport of proteins and lipids in the cell.

The smooth ER:

It aids basically in lipid production and processing.

The smooth endoplasmic reticulum, or smooth ER, is an organelle that is observed in animal cells and plant cells. Itd basic function is the production of cellular products such as hormones and lipids.

The rough ER :

It is the spot of secretory protein production.

Rough endoplasmic reticulum is observed in eukaryotic cells. Its basic aid is to synthesize proteins. It consists of cisternae, tubules and vesicles. The cisternae comprise of flattened membrane disks, that play a major role in protein modification.

Golgi apparatus:

It helps in further processing of the proteins produces for the rough ER and then in sending them off in vesicles to the plasma membrane.

It's often termed the cell's post office. It modifies, sorts and arrange proteins for secretion. It aids lipid transportation around the cell, and the production of lysosomes.

Lysosomes:

Its enzymes are synthesized and formed in the rough ER and Golgi apparatus. It aid hydrolysis of macromolecules e.g. phagocytosis and autophagy.

It is involved in digestion and waste removal by feeding on worn-out organelles, food molecules, and engulfed viruses or bacteria.

8 0
3 years ago
14. Scientists use models of earthquakes to (5 points)
bija089 [108]
Stop them from occurring
6 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • 1 ) HIV weakens the immune system by killing a. antibodies. c. helper T cells. b. B cells. d. killer T cells.
    13·1 answer
  • ______ energy is converted into_____ energy for use in living things.
    6·1 answer
  • How does technology affect the advancement of science
    11·2 answers
  • Can you write a short summary about DNA. The main facts and purposes plz and thankyou... WILL UPVOTE
    15·1 answer
  • Since both glycolysis and gluconeogenesis are irreversible processes, there is no thermodynamic barrier to their simultaneous op
    6·1 answer
  • What do we call an individual that has inherited two identical alleles for the same trait?
    5·1 answer
  • What is the correct answer???
    8·2 answers
  • An anti-antibody is an antibody directed against ____________________.
    14·1 answer
  • Rania went to the doctor with cold asked why she was getting nose blockage frequently and the doctor said it was because of the
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!