1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
defon
3 years ago
5

In which specimen were cells first identified

Biology
2 answers:
Arturiano [62]3 years ago
5 0

Answer:

cork (thin slices of cork)

Explanation:

Robert Hooke used the term "cell" in 1665. He made the first compound microscope, and he used it to see the cork cells. He took thin slices of cork and examined it under the compound microscope. He found smaller compartments in it. These compartments were arranged like a honeycomb structure. The cork was a dead plant part, hence inside of each compartment was empty.  He called the outer wall is the cell wall.

Masteriza [31]3 years ago
4 0

The specimen where cells were first identified was cork. Robert Hooke was examining a piece of cork using a microscope in 1665.

You might be interested in
Ethology is the study of animal _____.
Rzqust [24]
<span>Ethology is a branch of zoology concerned with the study of animal behavior. Ethologists take a comparative approach, studying behaviors ranging from kinship, cooperation, and parental investment, to conflict, sexual selection, and aggression across a variety of species.</span>
5 0
3 years ago
Read 2 more answers
Which of the following is an effect of ozone layer depletion? Bodies of water become acidic, disrupting ecosystems. Emphysema ,
mrs_skeptik [129]
C)There is an increased rate of skin cancer
7 0
3 years ago
Describe the process of preparing salad of your choice ​
suter [353]

Answer:

1.get everything that u want 2. yeet it in a bowl 3.mixit up and serve(if need to cut anything up, do that.)

Explanation:

6 0
3 years ago
What percent of all the genes in <br> e.coli are active all the time? 10, 20, 60, or 80%?
Sergio039 [100]
I kinda remember it and I think it's 60%
8 0
3 years ago
Read 2 more answers
This subcellular structure functions to modify gene expression products before they are shuttled out of the cell via exocytosis.
Over [174]

Answer:

The correct answer will be- Golgi apparatus

Explanation:

The proteins are synthesized in the ribosomes whether they are attached to the endoplasmic reticulum or free. These synthesized proteins enter the lumen of the endoplasmic reticulum where they get packaged to go to Golgi apparatus.

The Golgi apparatus is the site of post-translational modification of the secreted proteins like ubiquitination, acetylation, phosphorylation and many others.

Thus, the Golgi apparatus is the correct answer.

5 0
3 years ago
Other questions:
  • Please help!
    8·1 answer
  • What will be happening in a person after eight hours of sleep?
    13·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Dont answer if you're not sure
    12·1 answer
  • describe the three ways in which running water breaks up bedrock and three ways water transport sediment
    11·1 answer
  • When plants are stressed by dry conditions, they secrete the hormone abscisic acid (ABA) and in response the stomata close, even
    14·2 answers
  • A red blood cell is placed in a salty solution. When it shrivets due to loss of water, we say it has
    13·2 answers
  • Explain why fish die when they do not get enough oxygen​
    12·1 answer
  • What is the closest crop relative of Aloe vera?
    14·2 answers
  • Which of the following is true of water?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!