1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fomenos
3 years ago
14

When a blacksmith is working with hot metal, what places does the thermal energy go?

Biology
1 answer:
Juli2301 [7.4K]3 years ago
8 0

Answer:

The thermal energy is transferred to the anvil and hammer.

Explanation:

In metallurgical processes, part of the thermal energy present in the hot metal is transferred to the anvil and the hammer. This is because the anvil and the hammer have different temperature than the temperature of the hot metal. With that, part of the thermal energy of the metal will be transferred to the hammer and the anvil, in an attempt to balance the thermal energy in the 3 objects.

You might be interested in
Which best describes an acquired trait? A.An acquired trait is encoded in the DNA.
BaLLatris [955]
An acquired trait<span> is defined as a characteristic or </span>trait<span> that produces a phenotype that is a result of an environmental influence. </span>Acquired traits<span> are not coded for in the DNA of an individual and therefore cannot be passed down to offspring during reproduction

So the answer is </span><span>D. An acquired trait is developed during one’s lifetime.</span>
6 0
3 years ago
Read 2 more answers
What is a front?<br><br> -Air Masses and Fronts 9th grade science- <br> HELP ASAP
frez [133]

A air front is typically a transition zone between two unique temperature/humidity. Usually, one front would push the other away (typically if summer is hot, then the warm front will push away the cold, and for the winter, if it's cold, it's the opposite).

A stationary front, on the other hand, is when there is no change in the over all temperature for the region(s), and a occluded front is when the fronts mix, where it is followed by rain and a equillibrium of the temperature, whether to a warmer or cooler overall temperature.

~

5 0
2 years ago
What happens in each stage of Interphase?
den301095 [7]
Interphase is composed of G1 phase (cell growth), followed by S phase (DNA synthesis), followed by G2 phase (cell growth). At the end of interphase comes the mitotic phase, which is made up of mitosis and cytokinesis and leads to the formation of two daughter cells.
5 0
3 years ago
Compare and contrast aerobic and anaerobic respiration. We need to discuss the following points: stages involved, locations in t
Tomtit [17]

Answer:

Differences between aerobic and anaerobic respiration is whether or not oxygen is present. . During aerobic respiration, carbon dioxide, water, and ATP are produced. During anaerobic respiration, lactic acid, ethanol, and ATP are create, aerobic os used when heart rate and breathing rate rise, anaerobic is used during the first 1-2 mins of exercise, occurs in the cytoplasm of cells, while aerobic occurs in the mitochondria of the cells,  glycolysis occurs in both,  both are respiration, and both create ATP

Explanation:

7 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Other questions:
  • "steroid hormones are synthesized from amino acids" <br> a. True <br> b. False
    11·1 answer
  • What does there HT gene do for the plant that is incorporated into
    15·1 answer
  • I need help with this problem
    7·1 answer
  • Determine what happens if an egg is
    13·1 answer
  • Which condition is necessary for a mold fossil to form
    11·2 answers
  • Which is a point mutation?
    12·2 answers
  • What goes in and out of the cell, the cell membrane maintains ?<br><br><br>-Help me out
    7·1 answer
  • Match terms w definitions ​
    13·2 answers
  • Help please asap help me
    14·1 answer
  • The rainforest contains half of the Earth’s wildlife and at least two thirds of its plant species. It can hold great quantities
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!