1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ohaa [14]
3 years ago
9

Herbivores are also called _________________________.

Biology
2 answers:
mylen [45]3 years ago
8 0
Herbivores are also known as plant eating animals or primary consumers.
Vlad1618 [11]3 years ago
7 0

Answer:

fruitarian, phytophage , vegan, vegetarian , lactovegetarian , or lactarian

Explanation:

I don't know what you're looking for, but I'm pretty sure that all these are basically the same thing as herbivores, correct me if I'm wrong

You might be interested in
What is the primary function of the carbon cycle?
statuscvo [17]
The primary function of the carbon cycle is to recycle the supply of carbon on Earth.
4 0
3 years ago
Read 2 more answers
PLS HELP ILL GIVE BRIANLIEST LOL
Elena L [17]
Hey bro I don’t want you to be there I am so I don’t want you have a good night bro bro what are y’all doing
7 0
3 years ago
Read 2 more answers
4. What type of charge does a<br> proton have?
DedPeter [7]

Answer: Positive charge of 1

Explanation: This is because it is believed that it is from the charge of the quarks that make up the nucleons which are protons and neutrons.

8 0
3 years ago
Read 2 more answers
A substance that influences the reaction but does not participate in the reaction is a
Softa [21]
A catalyst
speeds up reaction
6 0
4 years ago
Read 2 more answers
Can anyone help me with this question??<br> Help!!
andrey2020 [161]
1990. Do not let the partial collapse during 1980s confuse you.
3 0
3 years ago
Other questions:
  • ________ believed that use (or lack of use) of body parts enables individual to develop certain traits that it passes on to its
    8·1 answer
  • Give an example showing how space can be a limiting factor for a population.
    12·1 answer
  • The fossil record shows that organisms in older rock strata are simpler than those found in younger rocks. This observation prov
    11·2 answers
  • Color blindness occurs when an individual is unable or has diminished ability to see certain colors. Red‑green color blindness i
    5·1 answer
  • What is the relationship between mutation, natural seleection, and adaptation
    5·2 answers
  • 1. Describe how water moves through the water cycle.
    10·2 answers
  • Which tool did maurice watkins use when studyng DNA
    6·1 answer
  • Name the two parts of CRISPR and explain what each does
    13·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • 9. What are groups of similar cells that work together to perform a specific function called? (1 point)
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!