1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexira [117]
4 years ago
5

Select the correct answer from each drop-down menu.

Biology
1 answer:
Gennadij [26K]4 years ago
6 0

Answer:

Vitamin C deficiency can result in disorders such as inflammation of collagen-formed tissues, such as cartilage, and hemorrhages of varying degrees. The severe lack of this vitamin produces a disease called scurvy.

Explanation:

Ascorbic acid or vitamin C is a water-soluble nutrient, necessary for the maintenance of the osteoarticular system, skin, hair and blood vessel function, as well as being a potent anti-oxidant and promoting iron absorption.  

The principal effects of vitamin C are due to its ability to intervene in the synthesis of collagen, as a cofactor of the enzyme α-ketoglutarate-dependent dioxygenases.

Vitamin C deficiency can lead to disorders related to blood clotting, the formation of hemoglobin or alterations of the orsteoarticular system and any tissue composed of collagen. Some disorders can be:

  • Anemia.
  • Joint inflammation
  • Hemorrhages
  • Poor wound healing.

Severe vitamin C deficiency can cause scurvy, a very rare disease today.

Learn more:

Vitamin C deficiency brainly.com/question/7223803

You might be interested in
Explain a biotic factor​
rosijanka [135]

Answer:

A biotic factor is a living organism that shapes its environment. In a freshwater ecosystem, examples might include aquatic plants, fish, amphibians, and algae. Biotic and abiotic factors work together to create a unique ecosystem.

Explanation:

Hope this helps : )

3 0
3 years ago
Read 2 more answers
As DNA is replicated, which DNA base pair will bond to cytosine ?
kirill115 [55]
<span>Adenine bonds with Thyamine Guanine bonds with Cytosine and vice-versa</span>
7 0
4 years ago
Read 2 more answers
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
tino4ka555 [31]

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

3 0
3 years ago
Meiosis is
kykrilka [37]
A is the correct answer.

4 0
3 years ago
Read 2 more answers
Brain cells and red blood cells receive most of their energy directly from_________
V125BC [204]
From oxygen and sugar
6 0
4 years ago
Other questions:
  • What is systematics and why is it a less arbitrary and more natural approach to categorizing living organisms?
    14·2 answers
  • When neither gene in a genotype pair is dominant and neither gene is recessive, the genes are said to be _____. multiple alleles
    6·2 answers
  • Question 3
    15·1 answer
  • A major function of a plant's roots is to...???
    10·1 answer
  • The tectonic cycle describes the movement of Earth's crust. Recycled "new" oceanic crust is formed by ______ at divergent bounda
    11·2 answers
  • The cytoplasm in a single celled organism and the circulatory system in a human both?
    6·1 answer
  • Cartilage has the unique ability to contract to pull the bones and help the body move
    6·1 answer
  • What are the tools used in mulching?​
    7·2 answers
  • Help please i will give brainlest
    14·2 answers
  • Think about the land in the region where you live. How was it shaped by plate tectonics? Is it still impacted by the movement of
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!