1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
N76 [4]
3 years ago
7

1 point

Biology
1 answer:
weeeeeb [17]3 years ago
5 0

Answer:

the ruptured cell

Explanation:

You might be interested in
When microbial action during decomposition in aquatic ecosystems removes too much oxygen, the body of water experiences .
pashok25 [27]

The body of water experiences eutrophication.  

The process of eutrophication takes place primarily in ecosystems with gradual changing waters, mainly in deep lakes. In the depths of the lake, where deposition of dead algae takes place, the aerobic bacteria, which feeds on them proliferate that in turn consumes more amount of oxygen.  

Though in the absence of enough circulation of water that is usually found in the case of deep lakes, the bottom of the lake is poorly oxygenated and the bacteria eventually deplete the oxygen found in the deep layers of water. Thus, they can no longer degrade all the dead organic matter and gets accumulated in the sediments. The lake is now considered to be aging.  


3 0
3 years ago
Why do plants has stalks that hold pollen higher in flowers???
Rama09 [41]

Answer: A

Explanation: due to gravity and aliens the pollen moves upwards instead of downwards , so taht bees can better access it .

7 0
2 years ago
Read 2 more answers
Each codon of a DNA molecule code is for a specific _
FrozenT [24]
Each codon of a DNA molecule code is for a specific __AMINO ACID__
4 0
2 years ago
1.
Greeley [361]

1.Aerobic respiration takes place in the mitochondria and requires oxygen and glucose, and produces carbon dioxide, water, and energy. The chemical equation is C6H12O6 + 6O2 → 6CO2 + 6H2O (glucose + oxygen -> carbon dioxide + water).

2.Respiration occurs when glucose (sugar produced during photosynthesis) combines with oxygen to produce useable cellular energy. This energy is used to fuel growth and all of the normal cellular functions.

3.A fundamental task of proteins is to act as enzymes—catalysts that increase the rate of virtually all the chemical reactions within cells. Although RNAs are capable of catalyzing some reactions, most biological reactions are catalyzed by proteins.

4.Aerobic respiration is characteristic of eukaryotic cells when they have sufficient oxygen and most of it takes place in the mitochondria.

5.The end product of anaerobic respiration is lactic acid instead of carbon dioxide and water. ... Hence, the amount of oxygen required to oxidize lactic acid to carbon dioxide and water is not present. Aerobic respiration produces 38 ATP whereas anaerobic respiration produces only 2 ATP molecules.

6.Anaerobic respiration occurs when the amount of oxygen available is too low to support the process of aerobic respiration. There are two main types of anaerobic respiration, alcoholic fermentation and lactic acid fermentation.

7.The end products of anaerobic respiration are Lactic acid or ethanol and ATP molecules. Anaerobic respiration takes place in the absence of oxygen and is seen in lower animals. During the process of Anaerobic Respiration in prokaryotes, there is a breakdown of glucose to produce energy for cellular activities.

8.Complete double ciruculatory systems allow for higher metabolic rates to be maintained as there is no mixing of oxygenated and deoxygenated blood. This means that blood leaving the heart to travel to the body is rich in oxygen.

9.ATP functions as the energy currency for cells. It allows the cell to store energy briefly and transport it within the cell to support endergonic chemical reactions. The structure of ATP is that of an RNA nucleotide with three phosphates attached.

10.Muscles cells contain more mitochondria because they have to release large amount of energy quickly for movement.

11.Carbohydrate loading is a type of diet where foods high in carbohydrates are eaten a few days prior to or right before an event; this is believed to help aid and provide energy during long- term endurance events. ... Carbohydrates are broken down by the body and turned into glycogen; which is stored in muscles.

12.Aerobic respiration takes place in presence of oxygen; whereas anaerobic respiration takes place in absence of oxygen. Carbon dioxide and water are the end products of aerobic respiration, while alcohol is the end product of anaerobic respiration. Aerobic respiration releases more energy than anaerobic respiration.

13.More blood is pumped to the exercising muscles to deliver that additional O. Without enough oxygen, lactic acid will form instead. Lactic acid is typically flushed from the body within 30 to 60 minutes after finishing up a workout. Tiny tears form in the muscles that help them grow bigger and stronger as they heal

14.The overall process of glycolysis is: Glucose + 2 NAD+ + 2 ADP + 2 Pi → 2 pyruvate + 2 NADH + 2 H+ + 2 ATP.

15.During these times, your respiratory and cardiovascular systems cannot transport oxygen to your muscle cells, especially those in your legs, fast enough to maintain aerobic respiration. To allow the continuous production of some ATP, your muscle cells use lactic acid fermentation.

7 0
3 years ago
What is the answer for the question?
Bingel [31]

Answer:

Vesicles.

Explanation:

Transport vesicles are able to move molecules between locations inside the cell. For example, transport vesicles move proteins from the rough endoplasmic reticulum to the Golgi apparatus.

4 0
3 years ago
Other questions:
  • PLEASE HELP RIGHT AWAY
    15·2 answers
  • According to “Making History with Vitamin C,” how did Cook persuade his men to want sauerkraut?
    7·1 answer
  • Please look at this picture and help me out (biology)
    7·1 answer
  • Which portion of a phospholipid molecule would be facing the environment outside of the cell?
    13·1 answer
  • A 1 M solution of glucose is 180 g of glucose in a 1 liter solution. If you wanted to make a solution of 0.2 M glucose, how many
    10·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • scientists estimate that only 1 percent of prokaryotes can be grown in the lab. what does this suggest about our knowledge of ba
    5·2 answers
  • When a somatic cell has both sets of chromosomes it is called
    10·1 answer
  • Large ears Survival Advantage
    11·2 answers
  • Lessening the emissions of which gas will lead to reducing ocean acidification
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!