1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kobusy [5.1K]
4 years ago
15

4. Corn kernels have an outer endosperm and an inner endosperm. A purple outer endosperm is dominant to a colorless (clear) oute

r endosperm. A yellow inner endosperm is dominant to a white inner endosperm. The inner endosperm color is not seen if the outer endosperm color is the dominant form. If the outer color is recessive or suppressed, the inner color is visible. In addition, the purple outer endosperm gene is suppressed and not expressed when a dominant color suppressor gene is present.
Biology
1 answer:
aleksley [76]4 years ago
4 0
OK so what are we trying to answer
You might be interested in
C6H1206 +602 +6CO2 + 6 H2O + ATP is the chemical equation for:
k0ka [10]

Answer:

It's the chemical equation for photosynthesis.

Explanation:

Glucose and oxygen combine and release water and carbon dioxide.

7 0
3 years ago
Read 2 more answers
Which of these is true regarding prokaryotes?
nalin [4]

Answer:c. Separated DNA is attached to the cell membrane before the cell divides.

Explanation:

The prokaryotes are single celled organisms. These are simple organisms which reproduce through asexual mode of reproduction that is cell division. They do not posses well define nucleus. Thus the genetic material remain in the cytoplasm of the cell. On cell division the genetic material (DNA) is distributed into halves for development of two daughter cells. Due to lack of nucleus and it's associated membrane the separated DNA get attach to the membrane before the cell actually divides.

4 0
4 years ago
How does the number of chromosomes in a sex cell compare with that in the parent cell?
natita [175]
<span>parent cell is diploid and sex cell is haploid</span>
8 0
4 years ago
Which allele for human blood type is recessive?
sergij07 [2.7K]

Blood type doesn't fall into the category of dominant/recessive genes exactly; rather it combines this with the properties of incomplete dominance. Ignoring the Rh factor, there are 3 alleles for blood type, I^a,I^b, and i. You will be type A if you have I^a I^a or I^a i and type B if you have I^b I^b or I^b i. You can also get type AB by having the combination I^a I^b or be type O if you have i i. If you need to use dominant/recessive, you can say the A and B allele are dominant over the O allele and codominant with one another.

7 0
3 years ago
Read 2 more answers
What might happen if there is inadequate calcium intake?
Ilia_Sergeevich [38]

Calcium would not be available to deposit during remodeling.

Hope this helps!

6 0
3 years ago
Other questions:
  • Peyer's patches are mucosa-associated lymph tissue located in the
    9·2 answers
  • In the stable form of protein, the ________ is generally oriented to the interior of the protein molecule.
    14·1 answer
  • during the race the body temperature of a runner increases. The runner body responds by perspiring (sweating), which lowers the
    6·2 answers
  • Ultraviolet radiation from the sun alters the DNA of a skin cell. This skin cell rapidly divides, but the resulting cells no lon
    14·2 answers
  • In chickens the dominant allele Cr produces the creeper phenotype (having short legs). However, the creeper allele is lethal in
    15·1 answer
  • Complete the following sentence.
    10·1 answer
  • Incomplete dominance
    9·1 answer
  • ATP is a compound produced by the body to:
    14·1 answer
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • 6. What is a dependent variable? Give an example from the reading.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!