1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lisabon 2012 [21]
3 years ago
14

I NEED HELP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! What are the five parts of skill related fitness. Please

select all 5 below. Question 1 options: Speed Muscular Strength Coordination Agility Balance Aerobic Endurance
Biology
1 answer:
ad-work [718]3 years ago
7 0

Answer:

the 5 are

Explanation:

running walking riding a bike and yoga!

You might be interested in
Energy from the sun arrives as electromagnetic radiation with a wide range of wavelengths and frequencies. Which form of electro
Dvinal [7]

On one end of the electromagnetic spectrum are radio waves, which have wavelengths billions of times longer than those of visible light. On the other end of the spectrum are gamma rays, with wavelengths billions of times smaller than those of visible light.On one end of the electromagnetic spectrum are radio waves, which have wavelengths billions of times longer than those of visible light. On the other end of the spectrum are gamma rays, with wavelengths billions of times smaller than those of visible light.On one end of the electromagnetic spectrum are radio waves, which have wavelengths billions of times longer than those of visible light. On the other end of the spectrum are gamma rays, with wavelengths billions of times smaller than those of visible light.On one end of the electromagnetic spectrum are radio waves, which have wavelengths billions of times longer than those of visible light. On the other end of the spectrum are gamma rays, with wavelengths billions of times smaller than those of visible light.On one end of the electromagnetic spectrum are radio waves, which have wavelengths billions of times longer than those of visible light. On the other end of the spectrum are gamma rays, with wavelengths billions of times smaller than those of visible light.On one end of the electromagnetic spectrum are radio waves, which have wavelengths billions of times longer than those of visible light. On the other end of the spectrum are gamma rays, with wavelengths billions of times smaller than those of visible light.On one end of the electromagnetic spectrum are radio waves, which have wavelengths billions of times longer than those of visible light. On the other end of the spectrum are gamma rays, with wavelengths billions of times smaller than those of visible light.On one end of the electromagnetic spectrum are radio waves, which have wavelengths billions of times longer than those of visible light. On the other end of the spectrum are gamma rays, with wavelengths billions of times smaller than those of visible light.On one end of the electromagnetic spectrum are radio waves, which have wavelengths billions of times longer than those of visible light. On the other end of the spectrum are gamma rays, with wavelengths billions of times smaller than those of visible light.On one end of the electromagnetic spectrum are radio waves, which have wavelengths billions of times longer than those of visible light. On the other end of the spectrum are gamma rays, with wavelengths billions of times smaller than those of visible light.On one end of the electromagnetic spectrum are radio waves, which have wavelengths billions of times longer than those of visible light. On the other end of the spectrum are gamma rays, with wavelengths billions of times smaller than those of visible light.On one end of the electromagnetic spectrum are radio waves, which have wavelengths billions of times longer than those of visible light. On the other end of the spectrum are gamma rays, with wavelengths billions of times smaller than those of visible light.On one end of the electromagnetic spectrum are radio waves, which have wavelengths billions of times longer than those of visible light. On the other end of the spectrum are gamma rays, with wavelengths billions of times smaller than those of visible light.On one end of the electromagnetic spectrum are radio waves, which have wavelengths billions of times longer than those of visible light. On the other end of the spectrum are gamma rays, with wavelengths billions of times smaller than those of visible light.On one end of the electromagnetic spectrum are radio waves, which have wavelengths billions of times longer than those of visible light. On the other end of the spectrum are gamma rays, with wavelengths billions of times smaller than those of visible light.On one end of the electromagnetic spectrum are radio waves, which have wavelengths billions of times longer than those of visible light. On the other end of the spectrum are gamma rays, with wavelengths billions of times smaller than those of visible light.On one end of the electromagnetic spectrum are radio waves, which have wavelengths billions of times longer than those of visible light. On the other end of the spectrum are gamma rays, with wavelengths billions of times smaller than those of visible light.On one end of the electromagnetic spectrum are radio waves, which have wavelengths billions of times longer than those of visible light. On the other end of the spectrum are gamma rays, with wavelengths billions of times smaller than those of visible light.

8 0
3 years ago
A chemotroph most closely resembles that of a(n) :<br> autotroph or heterotroph
Marina86 [1]
I think the answer would be an autotroph
3 0
3 years ago
What is morphogenesis?
gtnhenbr [62]

D) Development of an organism's shape

5 0
3 years ago
Read 2 more answers
cells can be observed in plants, animals, fungi, protists, bacteria, and archaea. which part of the cell theory?
Alexandra [31]

Answer:

The cell theory was given by Schwann and Schleiden. The fact that cells can be observed in plants, animals, fungi, protists, bacteria and archea comes from one of the postulates of cell theory- All living organisms are composed of  one or more cells.

Explanation:

The cell theory initially contained three postulates:

  1. The cell is the basic unit of organization in all organisms.
  2. All living organisms contain one or more than one cell.
  3. All cells arise from cells which are already in existence.

The discovery of cell was made by Robert Hooke. Later after further observations, more points were added to the cell theory like

  • The genetic component of the cell is DNA and is transferred within cells.
  • The <em>chemical composition</em> of all the cells is similar.
  • A flow of <em>energy</em> occurs within the cells.
7 0
3 years ago
A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
padilas [110]

Answer:

Explanation:

a. The template strand is:

ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT

The coding strand is

TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA

The sequence encoding the five amino acids is: 3' CTA-ATC-AGA-CCG-TAC-CAT 5'

b. 5' AUG-GUA-CGG-UCU-GAU-UAG 3'

c. N terminus Met-Val-Arg-Ser-Asp C terminus

d. GGAGGA

e. The shine Delgarno sequence as a mRNA binding site for mRNA's binding to the small subunit ribosome.

4 0
3 years ago
Other questions:
  • 4.6 Fusion of the reading frames of the bcr and abl genes, as is often observed in cases of chronic myelogenous leukemia (CML),
    11·1 answer
  • I need help finding a project for an 8th grader thanks nothing about volcanoes,solar system,batteries thank u
    7·1 answer
  • About 90% of the information you need to drive safely comes from your
    9·2 answers
  • The cranium is connected to the____ bones
    7·2 answers
  • What are three ways that the human body's internal environment may become unstable?
    9·1 answer
  • Ere are the solids that are removed from wastewater likely to end up after treatment
    12·1 answer
  • Explain what happens during the process of photosynthesis
    12·1 answer
  • Select all the correct images<br> Which organisms undergo Carnegie stages?
    15·2 answers
  • Which part of the heart takes blood from the veins and pumps it into a ventricle?
    15·1 answer
  • Choose one region on the world map. How does the climate their differ during El Niño and La Niña?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!