The intensity of light had greater impact on the rate of photosynthesis. It was observed that the jar in which the intensity of light was high, large amount of oxygen was produced as compared to the jar in which the intensity of light was low.
In the process of photosynthesis, oxygen is produced from the carbon dioxide. As the oxygen in the jar increases, the leaf disk rises with in the jar which also signifies the higher oxygen production with higher rate of photosynthesis in presence of high intensity of light.
Heart rate is controlled by the two branches of the autonomic (involuntary) nervous system. The sympathetic nervous system (SNS) and the parasympathetic nervous system (PNS). The sympathetic nervous system (SNS) releases the hormones (catecholamines - epinephrine and norepinephrine) to accelerate the heart rate.
Answer:
A:T;G:C
Explanation:
adenine goes with thymine unless it's mRNA and it will go with uracil. guanine and cytosine always go together.
Answer:
you have questions you ask them
you want to answer question then u get points
Thymine(T) pairs with adenine(A)
Adenine(A) pairs with uracil(U)
Cytosine(C) pairs with guanine(G)
therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT
is
AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA