1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ELEN [110]
4 years ago
4

Categorize each enzyme based on its specific function in glycolysis, gluconeogenesis, or both pathways.a. Triose phosphate isome

rase b. Glucose 6-phosphatase c. Hexokinase d. Fructose I ,6-bisphosphatase e. Phosphofructokinase f. Pyruvate kinase
Biology
1 answer:
Alex Ar [27]4 years ago
7 0

Answer:

a. Triose phosphate isomerase glycolysis

b. Glucose 6-phosphatase gluconeogenesis

c. Hexokinase  glycolysis & gluconeogenesis

d. Fructose I ,6-bisphosphatase gluconeogenesis

e. Phosphofructokinase glycolysis

f. Pyruvate kinase glycolysis

Explanation:

Triose phosphate isomerase is a protein that functions as an enzyme, and takes part in glycolysis, in the <em>interconversion of dihydroxyacetone phosphate and D-glyceraldehyde 3-phosphate</em>. Glucose 6-phosphatase is also a protein that works as an enzyme, it hydrolyzes glucose 6-phosphate given <em>glucose free</em> as a result. Hexokinase is a protein too, and is part of a wider group of enzymes. It <em>forms hexose phosphate by phosphorylating hexoses (six-carbon sugars)</em>. Fructose I ,6-bisphosphatase is an enzyme too, and it <em>tranforms fructose-1,6-bisphosphate into fructose 6-phosphat</em>e. Phosphofructokinase is an enzyme too, that works in changing a phosphoryl group from ATP to fructose-6-phosphate (F6P). Pyruvate kinase is an enzyme that catalyzes the <em>conversion of ADP tp ATP and phosphoenolpyruvate to pyruvate</em>.

You might be interested in
Rio salado
Novay_Z [31]

The intensity of light had greater impact on the rate of photosynthesis. It was observed that the jar in which the intensity of light was high, large amount of oxygen was produced as compared to the jar in which the intensity of light was low.  

In the process of photosynthesis, oxygen is produced from the carbon dioxide. As the oxygen in the jar increases, the leaf disk rises with in the jar which also signifies the higher oxygen production with higher rate of photosynthesis in presence of high intensity of light.  

7 0
3 years ago
What is the sympathetic nervous system and what are some of the effects it has on the body?
Alex Ar [27]
Heart rate is controlled by the two branches of the autonomic (involuntary) nervous system. The sympathetic nervous system (SNS) and the parasympathetic nervous system (PNS). The sympathetic nervous system (SNS) releases the hormones (catecholamines - epinephrine and norepinephrine) to accelerate the heart rate.
8 0
3 years ago
Which of the following correctly identifies the proper nitrogen base pairing in DNA
weeeeeb [17]

Answer:

A:T;G:C

Explanation:

adenine goes with thymine unless it's mRNA and it will go with uracil. guanine and cytosine always go together.

5 0
3 years ago
Hi im new how this work?
iren [92.7K]

Answer:

you have questions you ask them

you want to answer question then u get points

5 0
3 years ago
Read 2 more answers
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT
Eddi Din [679]

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

4 0
3 years ago
Other questions:
  • Inject DNA or RNA into the nucleus of a cell to reproduce.
    10·1 answer
  • Very simply, when using metagenomics, distinctions between bacterial species are based upon what?
    10·1 answer
  • Which statement about a jet stream is true? A. The winds flow only from south to north. B. The winds flow only from north to sou
    12·1 answer
  • About 225 million years ago, North America and South American were part of one huge landmass, Pangaea.
    9·1 answer
  • All forms of energy can be __________ into other forms of energy.​
    5·1 answer
  • When viewing a cork through his homemade microscope, Robert Hook discovered small compartments that he called _____.
    15·2 answers
  • How might a cave, an ant and a lake meet the needs of an organism?
    9·1 answer
  • In what way do prevailing winds effect precipitation in a region
    12·1 answer
  • Does predation involve abiotic biotic or both?
    15·1 answer
  • Describe what occurs during the process of seed development.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!