Rio salado

1 answer:

7 0

The intensity of light had greater impact on the rate of photosynthesis. It was observed that the jar in which the intensity of light was high, large amount of oxygen was produced as compared to the jar in which the intensity of light was low.

In the process of photosynthesis, oxygen is produced from the carbon dioxide. As the oxygen in the jar increases, the leaf disk rises with in the jar which also signifies the higher oxygen production with higher rate of photosynthesis in presence of high intensity of light.

You might be interested in

Which two organelles are found in plant cells but not animal cells

Inessa [10]

A large central vacuole, and chloroplasts.

8 0

3 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

Biuret's turned purple and the Sudan solution turned red

Helga [31]

Grapes Maybe?? Sorry I dunno, I just hear purple.

5 0

3 years ago

Read 2 more answers

What kind of fossil would a gastropoda shell must likely be?

DiKsa [7]

You didn't give any answer choices (i'm answering this through research and what i already know)

the first is fossilized dung, and that's not generally gastropod shells. A carbon film would be something thin, seeing as it's a film, and gastropods aren't that. A gastrolith is a stone swallowed by an animal to help with digestion, and that's also not a gastropod.

<span>Gastropod fossils may be molds, but usually aren't. Still, they can be. It's a better answer than; film or stomach stones.</span>

8 0

3 years ago

NEED HELP ASAP WILL GIVE BRIANLEST

Doss [256]

1.) atom ; tissue
2.) cell
3.) organ system
4.) true
5.) atom
6.) Particle

^-^

7 0

3 years ago

Read 2 more answers