4.75 billion years ago, a large star near what is now the Solar System went supernova, sending heavy element debris outward into the galaxy. Some of the debris, after traveling long distances through space, collided with a Hydrogen cloud.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
I think this information may be help you
The plants in a specific environment be impacted if there was a sudden drop in the amount of bacteria present in that area, there are positive and negative consequences associated with this situation.
Positive:
The decrease in bacterial colonization will prevent the plant from the diseases caused by the bacteria and this will promote plant growth. Like, black rot in Brassica caused by Xanthomonas campestris, bacterial canker in tomato, capsicum and chilli caused by Clavibacter michiganesis.
Negative:
Plants remains in symbiotic relationship with bacteria in order to obtain impermeable inorganic minerals from the soil. In the absence of bacteria, the plants will not receive these nutrients, and their growth may be hampered. Example bacteria fixes atmospheric nitrogen which is taken up by the root nodules of leguminous plants. In return these bacteria gets the food like carbohydrates produce by the plants
Explanation:
mitochondria is a double membrane bound cell organelle,oval or cylindrical in shape.
<h3 /><h3>function</h3>
- regulate calcium ions in cells
- formation of yolk
- help in synthesis of photosynthetic pigments
- can synthesize store and distribute energy in the form of ATP whenever required
Answer:
Even tho he is a bad person no.
Explanation:
Everyone should be treated with respect even if they don't respect you
