1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zina [86]
3 years ago
13

Can someone please help me I need the answer and don’t understand? Thanks

Biology
1 answer:
Harrizon [31]3 years ago
4 0
The answer is B

Isotonic mean that there is an even number of solutes inside and outside of the cell which is what this picture is referring to.
You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
In the kidney, the structures that filter the blood are the __________.
s344n2d4d5 [400]
*Glomerulus* -The tiny units within the kidney where blood is cleaned. Can also be known as Glomeruli.
8 0
3 years ago
Which component cannot be part of this strand?
Irina18 [472]
A- uracil, test prep question
4 0
3 years ago
Read 2 more answers
I need help with 6 please
Natasha_Volkova [10]
The answer is a desert
4 0
3 years ago
What chemical formula reflects the diagram
Elden [556K]
Chemical formula is a way of presenting information about the chemical proportions of atoms that constitute a particular chemical compound or molecule, using chemical element symbols, numbers, and sometimes also other symbols, such as parentheses, dashes, brackets, commas and plus (+) and minus (−) signs. These are limited to a single typographic line of symbols, which may include subscripts and superscripts. A chemical formula is not a chemical name, and it contains no words. Although a chemical formula may imply certain simple chemical structures, it is not the same as a full chemical structural formula. Chemical formulas can fully specify the structure of only the simplest of molecules and chemical substances, and are generally more limited in power than are chemical names and structural formulas.
5 0
3 years ago
Other questions:
  • Which property is generally characteristic of metallic elements?
    8·1 answer
  • Describe the structure of the layers of the skin (pp.178-184)
    11·1 answer
  • Figure 1 represents a segment of DNA. Radiation can damage the nucleotides in a DNA molecule. To repair some types of damage, a
    14·1 answer
  • Some organisms reproduce sexually. Other organisms reproduce asexually. What are some benefits of asexual reproduction?
    7·1 answer
  • A scientist makes a claim that two hominid species have a common evolutionary ancestor. Which of the following must happen to en
    15·2 answers
  • Atoms connected by covalent bonds share a ionic compounds. b pairs of electrons. c carbon and oxygen. d hydrogen ions.
    6·1 answer
  • Name two food making processes
    10·1 answer
  • The sun's _______ keeps planets in our solar system in orbit around the sun.
    5·1 answer
  • which tool is used to track which organisms are carriers of specific trait through several Generations​
    12·2 answers
  • Penicillium (the source of the antibiotic penicillin) is a mold that secretes a toxin that kills bacteria and other organisms. P
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!