1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tia_tia [17]
3 years ago
5

At a PO₂ of 70 mm Hg and normal temperature and pH, hemoglobin is ________% saturated with oxygen. At a PO₂ of 70 mm Hg and norm

al temperature and pH, hemoglobin is ________% saturated with oxygen.
A) 75
B) 50
C) 10
D) over 90
E) 25

Biology
1 answer:
Arturiano [62]3 years ago
4 0

Answer:

D) over 90

Explanation:

As we know, hemoglobin is the protein found in red blood cells that is in charge of oxygen transportation, and the relation between the percentage of oxygen that binds to hemoglobin and the partial pressure of oxygen in the blood can be represented through the oxygen - hemoglobin dissociation curve, as shown in the attached image.

As we can see in the image, the curve has a sigmoid shape, and this is due to the allosteric interactions between the subunits of the hemoglobin, which change their conformation with each oxygen molecule that binds in order to increase even more the oxgen affinity. This curve is constantly shifting to the right and to the left depending on the conditions of the blood, like temperature, pH, partial pressure of carbon dioxide and the concentration of diphosphoglycerate (DPG).

When the PO2 is around 70 mmHg, as we can see in the curve, the hemoglobin is saturated around 90% or more, reaching a plateu in the curve where the oxygen is not binding as fast anymore, because there are almost no more free binding sites left in the hemoglobin molecule.

You might be interested in
1. What is the name for the process that produces ATP?
photoshop1234 [79]

Answer:

photosynthesis

Explanation:

the formula for photosynthesis is

6CO2 + 6H2O + Light energy → C6H12O6 (sugar) + 6O2 +ATP

7 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
(39 points) pls help {Brainliest}
vagabundo [1.1K]

Answer:

you already got the answer so ima just type a answer

Explanation:

4 0
3 years ago
Read 2 more answers
Strep Throat, Anthrax, and Tetanus are examples of disease-causing bacteria called
romanna [79]

Answer: These are known as <u>pathogens.</u>

Additional:

- Anthrax is caused by <u>Bacillus anthracis</u>

- Strep throat is caused by <u>Streptococcus pyogenes</u>

- Tetanus is caused by <u>Clostridium tetan</u>

<u></u>

I hope my answer helped ⛄️

5 0
11 months ago
Read 2 more answers
What term means removing the nucleus from a cell?
Marina86 [1]
The answer is a because the CoraLatino so just choose a it’ll work because it happens
3 0
3 years ago
Other questions:
  • What structure supports the formation of a snowflake
    12·1 answer
  • Which climate condition is typically found in the tropics due to the interaction of the atmosphere and hydrosphere?
    9·1 answer
  • Select all that apply. Raw materials needed for photosynthesis are _____. chlorophyll carbon dioxide oxygen water nitrogen
    12·2 answers
  • Si un ser vivo no tiene hijos se puede reproducir
    15·1 answer
  • BRAINLIEST! Are fish mammals
    12·2 answers
  • When the waters which once covered Indiana retreated, they left behind a bedrock layer of
    12·2 answers
  • Explain how fitness and health maintenance result in a longer human life span
    9·1 answer
  • which pattern of inheritance is responsible for a wide range of phenotypes that result from Individual organisms having many dif
    8·1 answer
  • Which of the following is the simplest level of organization? Group of answer choices Organism Organ Tissue Cell Flag question:
    9·1 answer
  • Part B: Find Credible Sources
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!