1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksley [76]
3 years ago
13

Which observation proves that a cell is a eukaryote?

Biology
1 answer:
nika2105 [10]3 years ago
8 0
The answer is B. If a cell has a nucleus its a eukaryote
You might be interested in
Steroid hormones and thyroid hormones ________ pass across the plasma membrane; they cause the target cells to ________ that pro
tekilochka [14]

Answer:

can ,synthesize specific proteins

Explanation:

Hormones are chemical signals secreted by animals and plant that are capable of regulating body activities and maintain homeostasis.

They are transported in the circulatory system of the body

The action of hormones can be seen after the hormone has bound to its specific receptor found inside the cell.

For instance, steroid hormone and the thyroid hormones can pass through the plasma membrane to their receptors inside the cells.

When they bind with their receptors, the target cells will synthesize specific proteins that produce the characteristic effect of the hormone.

6 0
3 years ago
Does anybody know this answer?
yanalaym [24]
The 1st one is plasma membrane because it is the outside
the 2nd one is the cytoplasm because it is the middle part
the 3rd one is the nucleus because it is the center


p.s. I need brainliest i'm gonna lose a rank because i havent got enough brainliests
5 0
4 years ago
Which of the following is NOT an example of a fossil? *
denpristay [2]

Answer: mineral deposits can not be used as an example of fossil

Explanation:in evolution theory, both bones and footprints were used for fossil record

3 0
3 years ago
What is the effect of the number of days of germination on the rate of cellular respiration in seeds
hammer [34]

Answer:

The affect of germination on the rate of cell respiration in peas is that in peas that are germinated, the rate of cell respiration is higher because the cells are growing/going through mitosis which requires energy/ATP in order to be carried out which is generated through the process of cellular respiration.

6 0
3 years ago
Describe a situation in which you would choose to measure a liquid using the beaker instead of the graduated cylinder.
Dafna1 [17]
A beaker measure large volumes of liquids and shows the approximate measurement and is not a suggested tool for measuring precise measurements of liquid. A graduated cylinder measures the precise reading of the liquid and is the suggested tool for a exact measurement.

Hope this helps :)
7 0
4 years ago
Other questions:
  • What is the main function of the excretory system in mammals?
    6·1 answer
  • Is ammonium hydroxide a reactant or product
    9·1 answer
  • . Which of the following could be true of two different species that have a competitive relationship in the same ecosystem?
    7·2 answers
  • Insects are responsible for the destruction of a significant percentage of potential food harvests every year.
    10·2 answers
  • 13. What would be the complementary strand for the<br> DNA strand A-T-T-C-G-G-A-T.C?
    7·1 answer
  • Can anyone possibly have answers for these
    11·1 answer
  • Approximately when did primitive land plants appear?
    5·2 answers
  • A(n) __________ infection is a small region of infection from which a pathogen may move to another part of the body to establish
    14·1 answer
  • My eyes are green-blue. Blue-green eyes are my:
    13·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!