1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
belka [17]
3 years ago
9

Why do Galapagos sharks lie still on the ocean floor?

Biology
1 answer:
natka813 [3]3 years ago
8 0

Answer:

Either B. or D.

Explanation:

I don't know for sure, these two answers just seem better than the others.

You might be interested in
What strengthens and helps to maintain the fluid nature of a cell regardless of temperature?
Amanda [17]

Cholesterol in Cell membrane  strengthens and helps to maintain the fluid nature of a cell regardless of temperature

<u>Explanation:</u>

All organisms are made up of one or more cells. Each cell is protected or differentiated by a covering called as the cell membrane. Phospholipids are the basic structure of the cell membrane. Cholesterol prevents the loss of fluid from phospholipids.  

Cell membrane has a lipid layer and cholesterol which is placed between the phospholipids to maintain the fluid nature of the cell under different temperature. Cholesterol prevents the cell from solidifying and helps maintain the fluid. Cholesterol actually acts as a buffer between different temperatures.

3 0
3 years ago
12. Which type of rock is represented by the map symbol below?* A) clastic sedimentary rock formed from organic substances B) ch
MAVERICK [17]

Explanation:

There are three main types of rocks: sedimentary, igneous, and metamorphic. Each of these rocks are formed by physical changes—such as melting, cooling, eroding, compacting, or deforming—that are part of the rock cycle.

5 0
2 years ago
Why is diffusion important to cells
gavmur [86]
Diffusion is important to organisms because it is the process by which useful molecules enter the body cellsand waste products are removed. Digested food molecules (amino acids, glucose) move down a concentration gradient from the intestine to the blood.
8 0
3 years ago
Read 2 more answers
Based on the diagram, answer the following questions.
gregori [183]

Answer:

Left Earth: Northern

Right Earth : Southern

Bottom Earth Northern : Summer

Bottom Earth Southern : Winter

5 0
2 years ago
With rare exceptions, enzymes belong to the major organic substance group called _____.
sergey [27]
Proteins

Enzymes are proteins that can lower activation energy of reactions in the body (I think).
3 0
3 years ago
Other questions:
  • What are the internal and external regulators?
    6·2 answers
  • ________ produces short sequences of rna, which allows polymerase to synthesize a new strand of dna. dna primase dna helicase dn
    10·1 answer
  • What is the molecular formulas for penicillin, adenosine triphosphate, cholesterol, testosterone, and phenylalanine.
    10·1 answer
  • Number of cells in human compare to the number of bacteria cells on a human being
    13·1 answer
  • Select all that apply. Taxonomy _____. A)brings order to understanding the immense diversity of life B)is an unnecessary science
    10·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Defend or refute the conclusion that technology has improved animal agriculture.
    5·2 answers
  • Albinismisar are genetic condition that inhibits the production of melanin,or pigmentation,in the skin and hair. People born wit
    8·1 answer
  • What happens if your DNA has a mutation? What types of things can cause mutations?
    12·1 answer
  • What do economists call the inverse relationship between price and quantity demanded?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!