1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hoa [83]
4 years ago
12

2. Discuss how compounds in different types of organisms can be used to benefit people

Biology
1 answer:
Nimfa-mama [501]4 years ago
7 0

Answer:

Compounds from different organisms are being used widely bu humans for their benefits. Some of the compounds are used as drugs. For example, penicillin is used as a drug or antibiotic. There are many plants which provides humans with other types of medicines and herbal remedies. There are other compounds which are used for cancer treatment. For example, taxol is a compound obtained from trees which are being used as anticancer drugs.

You might be interested in
A mutation in the Ras protein renders Ras constitutively active (RasD). What is constitutive activation? How does constitutively
frosja888 [35]

Answer:

Constitutive activation is the alteration of a protein or signaling pathway such that it is functional or engaged even in the absence of an upstream activating event. For example, RasD is constitutively active because it cannot bind GAP and therefore remains in the GTP-bound, active state even when cells are not stimulated by growth factor to activate a receptor tyrosine kinase.

Constitutively active Ras is cancer promoting because cells will proliferate in the absence of growth factors, and thus normal regulatory mechanisms for cell proliferation are bypassed.

(a) A mutation that resulted in Smad3 binding Smad4, entering the nucleus, and activating transcription independent of phosphorylation by the TGFβ receptor would render Smad3 constitutively active.

(b) A mutation that made MAPK active as a kinase and able to enter the nucleus without being phosphorylated by MEK would render MAPK constitutively active.

(c) A mutation that prevented NF-KB from binding to IK-B or that allowed NF-KB to enter the nucleus and regulate transcription even when bound to IK-B would render NF-KB constitutively active.

5 0
3 years ago
The following is a specific immune response to the human immune system?
yuradex [85]

Answer:

Antibodies

Explanation:

Specific immune responses are triggered by 'antigens'. Antigens are found on the surface of a pathogen and is used to identify a specific pathogen. Antigens trigger the immune system to release cells that attach themselves to Antigens in order to kill off pathogens. These cells attack Pathogens using <em>antibodies</em>

3 0
3 years ago
What is the function of the hormone progesterone?
garri49 [273]

Answer:

Progesterone, hormone secreted by the female reproductive system that functions mainly to regulate the condition of the inner lining (endometrium) of the uterus. Progesterone is produced by the ovaries, placenta, and adrenal glands

Explanation:

5 0
3 years ago
Suppose that 1 mL of an enzyme solution can completely catalyze 10 mL of substrate in 8 minutes. Now suppose that you change the
VLD [36.1K]

Answer:

1. b. The reaction rate will remain steady over the entire 8 minutes.

2. c. The reaction rate approach zero before 8 minutes.

3. a. The reaction rate will be close to zero over the entire 8 minutes.

4. b. The reaction rate will remain steady over the entire 8 minutes.

Explanation:

When 0.5 mL of enzyme is introduced with water, the reaction will remain steady. When more substrate solution is mixed with water, then reaction will approach to zero depending on the amount of substrate mixed with water.

5 0
3 years ago
Diseases that cause the cell membrane to break/explode
CaHeK987 [17]

answer:

By permeating the cell walls and membranes, organic solvents such as alcohols, ether or chloroform can disrupt cells. These solvents are also used to lyse plant cells, in conjunction with shearing forces,

8 0
3 years ago
Other questions:
  • What is the basic unit of matter A.atomB.bacteriumC.cellD.molecule
    6·2 answers
  • Which animals like sunny weather?
    13·2 answers
  • Which of the following disorders results from the hypo-secretion of antidiuretic hormone (ADH)?
    7·2 answers
  • Using the key choices below, match the description given with the structure in the alimentary canal that it describes. Choices m
    6·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which homeostatic process is characterized by the diffusion of water molecules
    11·2 answers
  • Earth science
    13·1 answer
  • Your friend asks for your help checking their essay about sugar production and use in plants. They have found an online encyclop
    7·1 answer
  • Who had launched the highest number of internet satellites as of March 2020?
    15·1 answer
  • What change makes it difficult for organisms to survive
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!