1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
galina1969 [7]
3 years ago
7

A geologist notices that the land on one side of a break in the crust is slightly higher than the other side. What has the geolo

gist found?
a fold


a fault


an anticline


a joint
Biology
1 answer:
BartSMP [9]3 years ago
4 0

Um D? A fold?? If its right mark as brainleist please

You might be interested in
The four major components of the earth's crust are:
Elena L [17]
Inner core, outer core, mantle and crust
6 0
3 years ago
Read 2 more answers
Hen current increases and resistance remains constant what must happen to voltage? A) Voltage must decrease. B) Voltage must inc
trapecia [35]

Answer:

B

Explanation:

The statement typically depicts Ohm's law which can be mathematically represented as, I = V/R or V = IR. This representation means that as the current increases, the voltage also increases.

5 0
2 years ago
Read 2 more answers
A valley is noticeably lower than the surrounding area. What is one way a valley might form?
ratelena [41]
Though erosion due to water
4 0
2 years ago
Read 2 more answers
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
A certain species of plant has four unlinked genetic loci, w, x, y, and z. each genetic locus has one dominant allele and one re
Charra [1.4K]
The genotype of the plant is <span>WwXxYyZz.
The plant has a 50% chance of passing each of the alleles of a gene, the dominant or the recessive.
So, for  producing the haploid genotype of a gamete </span><span>Wxyz the chance is
0,5 (W)* 0,5 (x)* 0,5 (y) * 0,5( z)= 0,0625

</span><span>
</span>
3 0
2 years ago
Read 2 more answers
Other questions:
  • Which of the following are supported by many
    5·1 answer
  • What’s the difference in independent variable, dependent variable and controlled variable.
    6·1 answer
  • Hydropathy plot analysis of a protein of interest reveals a single, prominent hydrophobic peak. However, it is later discovered
    6·1 answer
  • Where do the semen cells come from
    14·1 answer
  • Which of the following is true about cells?
    15·1 answer
  • A prediction of the theory of Plate Tectonics is that new volcanoes can form at the boundary of two plates as magma seeps betwee
    13·2 answers
  • Humans have been on every continent in the world and can be found living in every biome.all of the members of the human species
    8·1 answer
  • A red blood cell (RBC) enters the cranial vena cava of a dog and makes its way to the femoral artery of the dog. Choose the corr
    5·1 answer
  • A liver cell has a volume of 5000 μm3. Its total membrane area, including the inner membranes lining organelles as well as the c
    7·1 answer
  • Which of the following statements BEST describes photosynthesis?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!