Inner core, outer core, mantle and crust
Answer:
B
Explanation:
The statement typically depicts Ohm's law which can be mathematically represented as, I = V/R or V = IR. This representation means that as the current increases, the voltage also increases.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
The genotype of the plant is <span>WwXxYyZz.
The plant has a 50% chance of passing each of the alleles of a gene, the dominant or the recessive.
So, for producing the haploid genotype of a gamete </span><span>Wxyz the chance is
0,5 (W)* 0,5 (x)* 0,5 (y) * 0,5( z)= 0,0625
</span><span>
</span>