1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
levacccp [35]
2 years ago
13

When a phosphate bond is hydrolyzed, energy is released. the remaining adp is at a higher or lower energy state?

Biology
1 answer:
Eduardwww [97]2 years ago
5 0
Answer:
The remaining ADP is at lower energy state.

Explanation:
ATP contain three phisphate bond. These phosphate groups form phosphodiester bond. Hydrolysis of each phosphate bond release about 7.3 Kcal of energy and one ADP. Now this ADP contain only one bond between phosphate group.

Result:
It is clered from the discussion that ADP is at lower energy level as compared to ATP due to less bond between phosphate group.
You might be interested in
Which part of the cell stores waste until it can be removed?
zavuch27 [327]

Answer: Vacuole

Answer choices:

<span>Cell membrane
Mitochondrion
Nucleus
Vacuole</span>

Vacuoles<span> are membrane-bound structures found in both  animal and plant cells. </span>

They have three important functions in plants --  provide support or rigidity, a storage for nutrients and waste matter until it can be removed,  and decompose complex molecules.

8 0
2 years ago
Earth’s outer core will not transmute S waves because it is made of ____.
IceJOKER [234]
A. Liquids
The earth’s outer core is a fluid layer approximately 2,400km thick
7 0
2 years ago
Read 2 more answers
Which of the following are necessary for a seed to germinate?
Tasya [4]
The answer is a im pretty sure 

3 0
3 years ago
What describes the basic structure of fatty acid
bagirrra123 [75]
<span>Fatty Acid- consists of a straight chain of an even # of carbon atoms, w/ hydrogen atoms along the length of the chain and at one end of the chain & a carboxyl group at the other end of it. I hoped this helped!</span>
6 0
3 years ago
2. Cellular respiration does not produce<br> O ATP<br> carbon dioxide<br> O glucose<br> O water
pochemuha
The answer is glucose.
3 0
3 years ago
Other questions:
  • Scientists found evidence of past glacial activity In Massachusetts. Which of the following conclusions is best supported by thi
    6·1 answer
  • A client is suspected of having acromegaly. what definitive diagnostic testing is the most reliable method of confirming acromeg
    10·2 answers
  • Which joint allows a side-to-side movement called lateral excursion?
    8·1 answer
  • During ________ , ATP is captured when a six-carbon sugar breaks down into 2 three-carbon compounds.
    7·1 answer
  • In COPD, the body attempts to improve oxygen-carrying capacity by increasing the amount of red blood cells. Which term refers to
    14·1 answer
  • What is the average for tge following set of measurements 7.1g,9.8g,2.3g,8.5g,7.4g,5.7g,
    13·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Anybody wannna talk rn
    15·1 answer
  • Distinguish between chromosomes, genes and DNA
    15·1 answer
  • What are the similarities of a animal cell and a red blood cell
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!