1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erica [24]
3 years ago
12

Human population projections are subject to change due to fluctuations in global fertility and mortality rates.

Biology
2 answers:
alekssr [168]3 years ago
8 0
It is <u>true </u>that human population projections are subject to change due to fluctuations in global fertility and mortality rates.
Although people can predict to a certain point what the future population will be like, they cannot predict all of the circumstances in which the population will be changed. They have to take into account mortality rates of people, as well as fertility levels in the future, which is impossible, which means that there projections aren't set in stone - they are likely to change quite a lot.
Korvikt [17]3 years ago
5 0
I am gonna assume that this is a true or false question if so the answer is true. <span />
You might be interested in
Which is not a source of carbon dioxide gas?
geniusboy [140]
Answer is
C. Plants
3 0
4 years ago
Read 2 more answers
___ proposed the polynucleic model, stating that dna and dna were composed of nucleotides.
hammer [34]
Levene proposed the polynucleic model, stating that DNA and DNA were composed of nucleotides.
7 0
3 years ago
Most living organisms are composed of whitch group of elements
Ugo [173]

Answer: In all living systems we can always find 4 basic elements: carbon, oxygen, nitrogen and hydrogen. Carbon is the basic building unit contained in living matter. The percentage of carbon in the mass of living matter is 19.4 %. Oxygen and hydrogen are present in almost all organic compounds which create living organisms.

Explanation:

7 0
3 years ago
Read 2 more answers
I need help pls I don’t understand
Yuri [45]

Answer:

a) (SO4)2 + Ba2 = BaSO4

b) (CO3)2 + 2H = H2O + CO2

c) NH4 + 2Na = Na + 2N + 2H

There u go :D

7 0
3 years ago
MARK AS BRAINLIEST AND ANSWER ALL THE QUESTIONS
White raven [17]

Answer:

when the salt outside of the paramecium is higher that the amount of salt inside a paramecium ,then they need all of the water they can get as a result they do not need contractile vacuole to contract.

ribosomes make protein which is found in cytosol.

lipids are present in the outer layer of the cell.

3 0
4 years ago
Other questions:
  • What is the body system that controls growth and metabolism, and regulates reproduction, through hormones?
    10·1 answer
  • Explain how you and a friend could be exposed to the same microbes and only one of you becomes sick.
    6·1 answer
  • Which is a kingdom?<br> Answer plantae? Mammalia? Arthropoda? Mollusca?
    9·2 answers
  • C) people who lack iron in their diets are at risk of anemia. this condition causes weakness in the body and a decreased capacit
    9·1 answer
  • State two functions performed by bile juice ​
    6·1 answer
  • Answer needed !ASAP!
    9·2 answers
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • What is biology give explanation​
    14·2 answers
  • When a red onion cell is placed in a 5% NaCl solution, the central vacuole will occupy
    7·2 answers
  • Now that you have had a chance to delve into epigenetics, think about how it applies to the argument between those who say we ar
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!