1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wolverine [178]
3 years ago
12

Mendel's law of segregation predicts the following specific phenotypic ratios among the F, and Fa progeny from crosses between t

wo pure-breeding parents for a single trait? A. F 1:0 F2 1:1 B. F1 1:0 F2 1:0 C. Fi 1:0 F2 3:1 D. F, 1:1 F2 3:1
Biology
1 answer:
aleksandrvk [35]3 years ago
8 0

Answer:

C. Fi 1:0, F2 3:1

Explanation:

Firstly, Mendel's law of segregation states that the alleles of a gene will randomly separate into gametes during gamete formation. In this case involving a single trait, hence, a single gene. Mendel crossed two purebreeding plants i.e. homozygous plants that produced different phenotypes for the same gene. He obtained his offsprings which he called F1 offsprings. He realized that all the F1 offsprings expressed only one phenotype. For example, when he crossed homozygous tall (TT) and short (tt) plants, he got F1 offsprings that were all tall.

He then self-crossed these F1 offsprings to produce a F2 offsprings that had a phenotypic ratio of 3:1 i.e. 3tall, 1short plant. He concluded that the alleles of the single gene had segregated into the gametes but one allele was capable of masking the expression of another, as seen in the heterozygous F1 offsprings that were all tall (Tt).

Hence, he obtained a 1:O ratio for his F1 offsprings then a 3:1 ratio for his F2 offsprings.

You might be interested in
1. What special structures are specific to the phylums of Porifera, Cnidaria, Ctenophora, and Platyhelminthes?
Marysya12 [62]

some of the special structures in the members of these phylum as follows:

Members of porifera are sponges. they have collar cells and cellular -level body organization. Cnidarian have stinging cells present on the tentacles around the mouth. Ctenophorans have comb-like plate cells for swimming. Platyhelminthes - members are first to have sensory and nervous tissue in the head region.


5 0
3 years ago
I am a fast-moving predator. My body has organs and
Amanda [17]

Answer:

snake? hawk? owl? eagles? Fox? Weasels?

Explanation:

Which one??

8 0
3 years ago
Which of the following are key features of prokaryotic cells? Select all that apply -ribosomes -cell wall. -nucleoid. -endoplasm
astraxan [27]

1st, 3rd, 5th

-ribosomes, nucleoid, plasmid

4 0
3 years ago
Read 2 more answers
5. Which of the following statements best explains the role of meiosis in reproduction?
kiruha [24]

Answer:

The correct answer is: Meiosis makes it possible for a zygote to have the correct number of chromosomes.

Explanation:

Meiosis is a type of cell division used by reproducing organisms to produce the gametes (as sperm or egg cells). It has two rounds of division that results in four cells with one copy of each chromosome.

Before the division, genetic material from each chromosome is crossed over and creates new combinations of code on each chromosome. During fertilization, the cells produced by meiosis will conjoin to create a cell with copies of each chromosome again, the zygote.

5 0
3 years ago
Read 2 more answers
PLEASE HELP!!! w(:_;)w(/´Д`)/
Tasya [4]
I confused On the question
8 0
3 years ago
Other questions:
  • What is atomic number
    13·1 answer
  • What are the skin layers from inside and outside of your body
    11·1 answer
  • What is the relationship between blood vessel length and blood flow?
    12·1 answer
  • What hormonal change occurs after fertilazation that causes the endometrial lining to remain intact so that the fertilised egg c
    11·1 answer
  • Which of the following disorders is by an individual who has the habit of eating to excess and then purging by vomiting?
    12·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Rosalind Franklin had strong skills in ___________.
    6·1 answer
  • 6. How do earthquake and volcano patterns support the idea of plate tectonics? (Multiple choice)​
    15·1 answer
  • Describe how a supernova and neutron star are related?
    13·1 answer
  • Please help <br><br> What are the two alleles of the seed color trait being considered here?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!