Answer:
The type of epithelium that lines the inferior portions of the pharynx is stratified squamous epithelium.
Explanation:
The pharynx is a structure made up of muscles and mucous membranes -like many internal organs- that is part of the respiratory system and is an intermediate step in the digestive tract.
This structure has two portions:
- <em>Upper or nasopharynx
</em>
- <em>Lower, or oropharynx, in contact with the airways.
</em>
Some even propose that the borderline surface between the pharynx and larynx can be called the laryngopharynx, due to its tissue structure.
The lower portion of the pharynx is covered by a squamous stratified epithelium, the inner layers of which rest on a basal lamina. The more superficial layers provide protection to the interior of the pharynx against friction, in addition to remaining lubricated by mucous secretion at that level.
Learn more:
Lower portion of the pharynx brainly.com/question/7300121
Answer:
So the mnemonic that I know is SNOW DROP. Southern=DNA, Northern=RNA, O=O, and Western=Protein. The question asks, "Which technique CANNOT be used to analyze gene expression?" and the answer is Southern because it is a "techniue used to detect a particular sequence in a sample of DNA."
✧･ﾟ: *✧･ﾟ:* *:･ﾟ✧*:･ﾟ✧
Hello!
✧･ﾟ: *✧･ﾟ:* *:･ﾟ✧*:･ﾟ✧
❖ Gregor Mendel wasn't able to prove his rules of inheritance using hawkweed (plant of the daisy family).
~ ʜᴏᴘᴇ ᴛʜɪꜱ ʜᴇʟᴘꜱ! :) ♡
~ ᴄʟᴏᴜᴛᴀɴꜱᴡᴇʀꜱ
Answer:
start process with gulcose
Explanation:
simple
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
