3 years ago

List factors to be considered for effective produce. in agriculture

1 answer:

4 0

Answer:

One of the most effective means of reducing potential problems is through proper field site selection. Three points should be considered when selecting a field to produce vegetables: field topography, soil type, and water availability and quality.

hope it helps please mark me brainliest

Explanation:

You might be interested in

It is not likely for a recessive lethal allele to completely disappear from the gene pool because it is maintained through______

zhannawk [14.2K]

The answer is C heterozygotes (carriers)

6 0

3 years ago

What does nervous tissue do?

arlik [135]

Answer:

Nervous tissue is found in the brain, spinal cord, and nerves. It is responsible for coordinating and controlling many body activities. It stimulates muscle contraction, creates an awareness of the environment, and plays a major role in emotions, memory, and reasoning.

Explanation:

6 0

3 years ago

Complete the table below about how each element is stored and cycled between living and non-living things.

olga2289 [7]

Answer:

Explanation:

it get recycled again when it becomes old

3 0

3 years ago

The establishment of a bird reservation is a way to (1 point)

never [62]

$\bold{ANSWER:}$

Last option: Preserve an ecosystem

$\bold{EXPLANATIONS:}$

• The establishment of a bird reservation is a way to preserve an ecosystem because reservation provides suitable environment to organism. A healthy ecosystem means large number of biodiversity.

5 0

3 years ago

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0

3 years ago

List factors to be considered for effective produce. in agriculture​

List factors to be considered for effective produce. in agriculture