1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lesantik [10]
3 years ago
15

Neapolitan ice cream is vanilla, chocolate, and strawberry ice creams combined in a 1:1:1 ratio. Briefly explain how neapolitan

ice cream is a good analogy that helps students understand the relationship between compounds and elements.
Biology
1 answer:
alekssr [168]3 years ago
6 0

Neopolitan ice cream refers to an ice cream compound, that is, it comprises an amalgamation of three distinct elemental ice cream flavors: vanilla, chocolate, and strawberry in equal ratio.  

If one wants, then one can distinguish the three flavors from each other with the help of a knife. This analogy can permit one to witness that how the elements can be combined with each other to produce new components or dissociated into their elements.  


You might be interested in
What is the primary source of energy in a food chain?
lakkis [162]
2) the answer is the sun
5 0
3 years ago
Read 2 more answers
Which phrase is not an example of intercellular communication?
Dmitry [639]

Answer:

1.

Explanation:

A signal from one gland to another would not be intercellular, as "inter" means inside. This means intercellular would stand for "Inside the Cell"

8 0
3 years ago
Which describes the dependent variable in an experiment
Reika [66]
<span>It is the variable in an experiment is not directly altered</span>
4 0
3 years ago
Which list shows in correct order the fewest stars to the greatest number of stars?
madam [21]

Answer:

Option C.

our solar system, the Milky Way Galaxy, the universe

Explanation:

The Solar system comprises of the star and all its planets, comets, asteroids and also other bodies. It is very larger than a star.

The milky way galaxy comprises of group of solar systems that orbit around a central core . The galaxy normally have very big hole in their centre.

The Universe contain billions of galaxies and it comprises of everything, asteriod, moon, planet, star, solar system,galaxy.....

3 0
3 years ago
The final stage of mitosis during which the chromosomes migrate to the pole me of the cell and unwind
Zarrin [17]
The final stages of mitosis which match your description are telophase and cytokenesis.
6 0
3 years ago
Other questions:
  • A change in one or a few nucleotides that occur at a single point in the DNA sequence
    15·1 answer
  • True or false: the generation of haploid gametes is essential for humans to remain diploid organisms. true or false: the generat
    11·1 answer
  • Double fertilization in angiosperms is most similar to ______.
    9·2 answers
  • Please help me!!!!!!!!!
    15·1 answer
  • HELP ASAP PLEASE!!!!
    12·1 answer
  • What is the point of inserting needles into incorrect places?
    6·1 answer
  • Imagine you were an animal that lived in the tundra. What are three adaptations that would help you survive by either finding fo
    6·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Which molecules are the products of aerobic respiration?
    10·2 answers
  • What is the number of different species of plants and animals in an area
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!