1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DedPeter [7]
3 years ago
14

Describe two examples of steroids. For Each example, describe its physiological function

Biology
1 answer:
NARA [144]3 years ago
6 0


Testosterone is an example of a steroid.  Its physiological functions include:

1. Determines the the gender of a developing embryo.

2. Development of reproductive organs and the prostrate gland in males.

3. Responsible for secondary sexual characteristics in males such as deeper pitch, increased muscle bulk, hair on the upper lip.

4. Regulates normal sperm development.

Another steroid is cholesterol. Physiological functions include:

1. Helps maintain the structure  of cells and vessels improving overall health and function in the body.

2. Precursor to important sex hormones such as testosterone and estrogen.

3. Used as an insulator around nerves and is absolutely essential for brain function.

4. Precursor to Vitamin D,  which supports a healthy immune and nervous system

 

You might be interested in
MGA LAYUNIN
Naddik [55]

TAJJDIAJEVKZLSJBXMAKWJFHBSMAKDJBZJAKXHABKWJD

3 0
3 years ago
What are 3 fundamental axes of rotation​
Ber [7]

Answer:

Explanation:

Just as there are three planes of motion, there are three axes of rotation: the anterior-posterior axis, the mediolateral axis, and the longitudinal axis

3 0
3 years ago
As the sarcomere contracts which band becomes smaller? Which band remains the same?
KengaRu [80]
Anatomy During Contraction

-Sarcomere, itself, is shorter
-H-zone is shorter (part of A-band that doesn't have actin filaments in it)
-I-band gets shorter (part of sarcomere lacking myosin)
-A-band stays the same size (zone that contains myosin)

8 0
3 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
What does meiosis and mitosis have in common
maksim [4K]
The same general processes occur in meiosis and mitosis 
8 0
3 years ago
Other questions:
  • Inhalation and exhalation move air into and out of the lungs. what happens when you inhale and exhale? drag the labels to the co
    8·1 answer
  • Two species of meadowlark have different mating calls that lead to reproductive isolation. What type of isolation does this exam
    14·2 answers
  • You observe a microbial colony on glycerol yeast agar. this microbe is likely to be
    7·1 answer
  • 1. Create a Punnett square to calculate the possible genotypes that can result from a cross between the two parent plants. In a
    15·1 answer
  • What part of the body is damaged by a sprain
    14·1 answer
  • What does not occur in interphase?
    14·1 answer
  • Darwin’s theory of evolution by natural selection has been solidly demonstrated.
    7·1 answer
  • Which type of organism developed first?
    7·1 answer
  • Why do bans on ivory trade not stop elephants<br> from being slaughtered?
    14·1 answer
  • Application of pesticides cause profound<br> ... in the normal microbial activity in the soil
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!