Before - question, research, hypothesis, experiment, conclusions
Answer:
the population can increase rapidly when the conditions are favourable
only one parent is needed
it is more time and energy efficient as you don't need a mate
it is faster than sexual reproduction
The right matches are :
A. bryophyte ==> 3.
B. pteridophyte ==> 2.
C. gymnosperm ==> 1.
D. angiosperm ==> 4.
These four types of plants are cormophytes.
Bryophyte is a terrestrial plant belonging to the family Bryophyta, which does not have a real vascular system.
Gymnosperms are the first order of didynamy containing phanerogamous plants whose eggs are not enclosed in closed carpels.
Angiosperms are plants whose seeds are enclosed in a closed ovary.
Pteridophytes produce neither flowers nor seeds but are vascular plants.
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.