1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lana71 [14]
2 years ago
14

Water is used to cool down automobile engines when they get hot. Why is water used as a coolant?

Biology
2 answers:
Alex_Xolod [135]2 years ago
6 0
Because it’s wet and has a low PH so it’s a coolant
Tanzania [10]2 years ago
4 0

Answer:

Water is used as a coolant because water has a low heat capacity and that is the answer.

The answer is letter (D) Water has a low heat capacity.

Explanation:

You might be interested in
If you follow the scientific method, you must form a hypothesis............... performing experiments.
Igoryamba
Before - question, research, hypothesis, experiment, conclusions
5 0
3 years ago
In thinking about the asexually reproducing creatures in this simulation, what advantages did their reproduction style have in e
Maurinko [17]

Answer:

the population can increase rapidly when the conditions are favourable

only one parent is needed

it is more time and energy efficient as you don't need a mate

it is faster than sexual reproduction

6 0
3 years ago
In kolhbergs conventional stage of moral development moral decisions are based on?
butalik [34]

Answer:

b

Explanation:

7 0
2 years ago
Match the description of each plants with the group to which the plant belongs. (Match each number to a letter please!)
Hoochie [10]

The right matches are :

A. bryophyte  ==> 3.

B. pteridophyte  ==> 2.

C. gymnosperm  ==> 1.  

D. angiosperm  ==> 4.


These four types of plants are cormophytes.

Bryophyte is a terrestrial plant belonging to the family Bryophyta, which does not have a real vascular system.

Gymnosperms are the first order of didynamy containing phanerogamous plants whose eggs are not enclosed in closed carpels.

Angiosperms are plants whose seeds are enclosed in a closed ovary.

Pteridophytes produce neither flowers nor seeds but are vascular plants.


7 0
3 years ago
Read 2 more answers
Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
umka2103 [35]

Answer:

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Explanation:

<em>The complementary strand is :</em>

(5')GCGCAATATTTTGAGAAATATTGCGC(3')

<em>The base sequence of the complimentary strand is:</em>

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Because this sequence is self-complementary, the individual strands can form  hairpin structures. The two strands together may also form a cruciform.

Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.

  1. DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis,  bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
  1. Hairpins can also be formed from double-stranded DNA  as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
6 0
2 years ago
Other questions:
  • What structure of the sarcomere shortens during muscle contraction?
    8·1 answer
  • The _________ is the part of the backbone that connects the different backbones together.
    11·1 answer
  • When carbonate minerals come into contact with hydrochloric acid they
    13·2 answers
  • The hot expanding gases generated by the combustion reaction in the engines are:
    8·2 answers
  • Which pair of elements would be expected to form an ionic bond?
    10·2 answers
  • The cookie cutter shark feeds by taking a bite of flesh out of whales and large fish. The shark does not kill the larger fish it
    5·1 answer
  • Which of the following is true about science?
    9·2 answers
  • Barbara has curly hair. Her genotype for this trait is CC. What do you infer from this?
    8·2 answers
  • I need help like asap thank you very much
    7·2 answers
  • Help!!!!!test(APX)(right answers only)
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!