1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
love history [14]
2 years ago
9

The "brain" of the cell is called the

Biology
2 answers:
BARSIC [14]2 years ago
6 0

A. nucleus because it is in the center of the cell and it’s the core of the cell

nordsb [41]2 years ago
4 0

A. Nucleus because it is the center

You might be interested in
Mendel believed that during the formation of gametes, the pair of genes controlling a trait separate. He called this the princip
r-ruslan [8.4K]
Hello There!

<span>Mendel believed that during the formation of gametes, the pair of genes controlling a trait separate. He called this the principle of segregation.
</span>
Hope This Helps You!
Good Luck :) 

- Hannah ❤
6 0
2 years ago
Read 2 more answers
2. Which statement best describes the process of evolution?*
andreyandreev [35.5K]

Answer

. Populations grow when resources are abundant

6 0
3 years ago
3. List three other types of evidence that plants existed in Antarctica. (besides that there were plant fossils found)
GalinKa [24]

The three evidence that support the existence of plants on Antarctica are:

- Climate;

- Pollen;

- Herbivorous animals;

Apart from the plant fossils found on Antarctica, there are few other evidence that suggest that plants existed in the past on the now frozen continent. Some of those evidence for the existence of plants on Antarctica are the pollen found in the rocks and fossils of organisms, the climate records, as well as the herbivorous animals.

The pollen is only released by the plants, thus that is a sure indicator that plants were occupying this part of the world.

The climate records on Antarctica that can be seen in the rock layers, suggest that for most of its existence, Antarctica had a warm and wet climate, which is perfect conditions for the plants to thrive.

The herbivorous animals are feeding themselves on plant material, so since there's fossils of herbivores in Antarctica, it for sure is an evidence that there were plants existing in order for them to feed and be able to live in there.

3 0
3 years ago
Please help me to answer this questions. If you help me to answer it I will give you brainiest​
disa [49]

Answer:

a. Mercury, Venus, Earth, Mars, Jupiter, Saturn, Uranus, Neptune.

b.  Mercury, Venus, Earth, and Mars.

c. Neptune, Uranus, Saturn, and Jupiter.

Explanation:

a. Name the planets of the solar system in order :

Mercury, Venus, Earth, Mars, Jupiter, Saturn, Uranus, Neptune.

b. Name the rocky planets.

Mercury, Venus, Earth, and Mars.

c. Name the gas giants.

Neptune, Uranus, Saturn, and Jupiter.

4 0
2 years ago
Read 2 more answers
Explain why there are long necked tortoises in the galapagos Islands as opposed to the smaller ones found in North America. (Use
Gnom [1K]

The Galapagos tortoise has adapted to its environmental situation, such as the North American turtle has adapted.

7 0
2 years ago
Other questions:
  • How are different populations able to live in the same community?
    15·1 answer
  • Bacteria can be treated with antibiotics such as
    10·1 answer
  • How do stomata function in most plants relative to gas exchange?
    12·1 answer
  • 2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
    14·1 answer
  • With an ethnocentric approach, a company applies the morality used in its ________. A. host nation B. industry C. general societ
    12·1 answer
  • What is a dramatic environmental event?
    9·1 answer
  • which statement best describes vascular tissue in seed plants xylem carries food produced by the leaves to the rest of the plant
    5·2 answers
  • A major function of serous membranes is to decrease friction. True or False
    6·1 answer
  • If individuals with this trait survive the season and breed, what would best
    9·1 answer
  • Who is in the same trophic level as the frog? Select all that apply.
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!