1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Inessa [10]
3 years ago
9

After 2 weeks of radiation therapy for cancer of the breast a client experiences some erythema over the area being irradiated. t

he area is sensitive but not painful. the client states that she has been using tepid water and a soft washcloth when cleansing the area and applying an ice pack three times a day. what does the nurse conclude from this information
Biology
1 answer:
gayaneshka [121]3 years ago
7 0
The correct answer is that "further teaching on skin care is necessary". This patient is using tepid water to cleanse the area as well as applying ice three times a day. The nurse should educate the patient that the extremes of temperatures are not necessary and should be avoided such as warm to hot water as well as cold water or even ice. Cold water or ice will constrict blood vessels in the area and can produce tissue necrosis by ischemia. Warm to hot water can scald the skin (if hot enough) and even promote the redness as warm water dilates blood vessels.
You might be interested in
The term gender refers to:
Tom [10]

Answer:

a. cultural categories related to the identities and roles of men and women

Explanation:

Gender can be defined as that which identifies and differentiates men and women, that is, male and female. According to the “traditional” definition of gender, it can be used as a synonym for “sex”, referring to what is proper to males as well as females. However, from the point of view of the social sciences and psychology, mainly, gender is understood as what socially differentiates people, taking into account the historical-cultural patterns attributed to men and women, so we can Consider that the letter A, is the answer to your question.

7 0
3 years ago
Stem regions at which leaves are attached are called ________.
Karolina [17]

Answer:

Nodes

Explanation:

A node is a stem zone where the leaves are attached, the stem portion between nodes are called internodes, the thricomes are like little hairs in the leave and the lenticels are spaces in the leave that helps to transpiration like the stomata.

So, the stem regions at which leaves are attached are called nodes.

Also the name nodes is really common in gardening, it helps a lot to identify which leave are they talking about.

7 0
4 years ago
Tasha went on a trekking expedition to a mountain range during her vacation. When she reached a particular elevation, it started
aleksandrvk [35]

Answer:

It should be geosphere.

Explanation:

3 0
3 years ago
Which of the following best describes why in general there are more hares in the ecosystem than foxes.
djverab [1.8K]

Answer:

<u>C</u>

Explanation:

The reason why there are more hares than foxes in the ecosystem is because if only 10% of the energy gets passed on to the next trophic level, then you need to have more lower level animals available to supports the animals higher up the food chain. The fox must eat several hares to gain enough energy for growth and development.

8 0
2 years ago
Read 2 more answers
How much does fast forward surgical teams get paid?
SVETLANKA909090 [29]
The answer is a very good amount.....
4 0
3 years ago
Other questions:
  • Which is the proper procedure for delivering prepared hot food off-site? 1. drive to the off-site location as quickly as possibl
    10·1 answer
  • Which situation shows potential energy being transformed into kinetic energy? A car stopped at a stoplight A flowerpot falling f
    11·2 answers
  • The Honeydough Bread factory produces 2,000 loaves of bread per day.
    14·1 answer
  • Scientific Question: What is the effect of major flooding events on adult and juvenile trout
    9·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Do you think that Humanity should make the effort to colonize space?
    9·2 answers
  • What would happen if Glucoses could not happen in a cell
    9·1 answer
  • Which of the following statements is true regarding the movement of substances across cell membranes?
    11·1 answer
  • All birds lay their eggs on land.
    7·1 answer
  • Which eye structure is primarily responsible for making the adjustments required to focus on objects both near and far?.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!