1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DochEvi [55]
3 years ago
5

Order the parts of the digestive system to trace the path of a bolus of food from ingestion to excretion. Use the correct answer

s provided below as a guide.
A) 1 = Food enters the mouth
B) 3 = Esophagus
C) 4 = Stomach
D) 8 = Cecum
E) 15 = Feces is expelled
Biology
1 answer:
n200080 [17]3 years ago
6 0

Answer:

A) Food enters the mouth

B)  Esophagus

C)  Stomach

D)Cecum

E) Feces is expelled

Explanation:

The food is ingested through the mouth and and then it is transported through the esophagus to the stomach from where it reaches the small and large intestine and then it is finally expelled as undigested or waste foo product.

Based on the above brief explanation, the flow chart depicting food movement are as follows -

a) Food enters the mouth

b) Esophagus - known as the food pipe

c) Stomach

d)Cecum - it is a small pouch connected to small and large intestine.

e) Feces is expelled through rectum

You might be interested in
In illumina nest generation sequencing the nucleotides are identified by
pshichka [43]

Answer:

Step 3 in NGS Workflow: Data Analysis

After sequencing, the instrument software identifies nucleotides (a process called base calling) and the predicted accuracy of those base calls. During data analysis, you can import your sequencing data into a standard analysis tool or set up your own pipeline.

Explanation:

Hope this helps you

3 0
3 years ago
In fruit flies, red eyes (R) are dominant to white eyes (r).
inna [77]
r r
_ _
R|Rr Rr|
R|Rr Rr|
____
6 0
3 years ago
Determine tRNA anticodons<br> UACCUGUUAAGCUACAAAAUU
Pavel [41]

Answer:

i dont know sorry , Gooqle it

7 0
2 years ago
Potatoes are native to Monuntainous areas of Bolivia and Peru in South America, but are now grown widely around the world. What
Softa [21]

Answer:

Potatoes grew in the mountainous regiosn of Bolivia and Peru because they prefers such climates. Climates that are on the cold side but not so cold that the ground would be frosty. A temperature of between 60° to 70°F is considered ideal and anything above 80° F is considered too warm for them even though they have been known to adapt.

The soil should be very mildly acidic with a pH of between 5.0 to 5.5. Potatoes prefer to be grown in the full presence of the sun in well drained soils that are not compact or constantly wet.

The Environmental conditions are therefore;

  • Cold but not too cold
  • Well drained soil
  • Mildly acidic soil.
  • Abundance of sunlight.
4 0
3 years ago
Is this trait dominant or recessive
Alex73 [517]
This trait is recessive
3 0
3 years ago
Other questions:
  • What substances must pass through a cells membrane for the cell to continue to function?
    7·1 answer
  • Which process requires no energy from the cell
    5·1 answer
  • Use the following study to answer the following question: A researcher applies varying amounts of fertilizer (0, 2, 4, 8, 10 uni
    7·1 answer
  • Where was BSE first detected in the mid 1980’s?
    9·1 answer
  • A palpable pulse that presents with a chaotic rhythm and no predictable pattern is​ called:
    6·2 answers
  • When Surita sees a man walking around the shopping mall in December and notices that he is very robust, has a long white beard,
    12·1 answer
  • Why heart is vrey important.
    6·2 answers
  • Describe what a limiting factor is and describe how each factor impacts the rate of photosynthesis.
    8·1 answer
  • Plzzz helpppp!!!! and answer the question ​
    8·1 answer
  • Explain about Dengue<br> bye going offline<br>​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!