1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OverLord2011 [107]
2 years ago
11

Extinction of a species is most likely to occur as a result of __________.

Biology
2 answers:
sweet-ann [11.9K]2 years ago
8 0
D
This is because of greenhouse gases and polution.
Marta_Voda [28]2 years ago
7 0
The answer is <span>d) 
environmental changes</span>
You might be interested in
Natasha is looking for a material to make tires for a new jogging stroller she designed. Which would be best suited to her produ
V125BC [204]

Answer:

vulcanized rubber

Explanation:

The best material for this purpose is vulcanized rubber. Jogging strollers have wider bases and larger wheels to stabilize them, and these wheels must be durable in order to withstand the stresses introduced during the high speed movement.

6 0
3 years ago
Read 2 more answers
Which of the following terms are correctly matched with its definition?
Alik [6]

Answer:

3) Isotonic

Explanation:

ISO —> =

Hypo < Hyper

Hyper > Hypo

6 0
3 years ago
diagram represents one of Mendel’s laws or principles of inheritance. F 1 includes Upper G g and Upper G g. F 2 includes Upper G
rusak2 [61]

Answer:

The diagram represents the Law of Dominance

Explanation:

Any particular trait can be dominant or recessive in an individual who is heterozygous for it depending on their inheritance pattern from the parent genotype. Although the individual will be carrying the recessive allele in their genetic code too, it is only the dominant phenotype that is expressed. The dominant trait is represented by the capital letter whereas the recessive trait is represented by a small case letter.

6 0
3 years ago
Read 2 more answers
The reactants that go into the enzyme promoted chemical reaction are also called
Natalija [7]

Answer: Substrates im pretty sure

Explanation: mark brainliest pls

3 0
3 years ago
How does a swim bladder help the ray finned fishes maintain buoyancy
Lelu [443]

Answer: Swim bladders of fish at depth help maintain buoyancy by regulating gas levels.

8 0
2 years ago
Other questions:
  • Studies show that the use of fat replacers will reduce the risk of obesity. false
    5·1 answer
  • If the pH of a solution is 5, what its the pOH
    10·1 answer
  • Learning goal 1: Plastics are:<br>:natural<br>:synthetic​
    14·2 answers
  • Which line from Chaucer’s “General Prologue" to The Canterbury Tales is a reference to the feudal social structure of medieval E
    12·1 answer
  • which statement best distinguished the light dependent (L-D) reactions from the light-independent (L-IND) reactions?
    5·1 answer
  • There are 25 elements found in living things. How many of these elements are found in some organisms but not all?
    7·2 answers
  • Which of these factors will affect the friction on a road?
    8·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • 4. In the process of precipitation, water vapor in air cools and becomes water droplets that clump around particles in air to fo
    8·1 answer
  • Can anyone please help ​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!