1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
katovenus [111]
4 years ago
10

Consider the following food chain:

Biology
2 answers:
icang [17]4 years ago
8 0
D. that is the correct answer
Triss [41]4 years ago
5 0

the answer is d i just took the test










































You might be interested in
A molecule of water is made from.
stealth61 [152]

Answer:

H2O

Explanation:

Water molecule is made of 2 hydrogen atoms bonded with covalent union (sharing electrons) with 1 oxigen molecule

6 0
3 years ago
Please help with biology
mestny [16]

picture doesnt show my dood

5 0
3 years ago
How would the introduction of a nonnative species most likely affect biodiversity in an ecosystem?
VikaD [51]
C.
The nonnative species would not affect biodiversity because it's unlikely the species would survive.
4 0
3 years ago
Read 2 more answers
Is energy stored when ATP is hydrolyzed?
Vera_Pavlovna [14]

Answer: ATP hydrolysis is the catabolic reaction process by which chemical energy that has been stored in the high-energy phosphoanhydride bonds in adenosine triphosphate (ATP) is released by splitting these bonds, for example in muscles, by producing work in the form of mechanical energy.

Explanation: Mark me as (brainlisti) pls

7 0
3 years ago
What scientist proposed the theory of evolution by natural selection? Ramey Lyell Darwin Malthus
nadya68 [22]

Answer:

charles darwin

Explanation:

5 0
3 years ago
Other questions:
  • What is the biological reason for fevers? Select one: a. They increase the activity of white blood cells. b. They speed up growt
    13·1 answer
  • During the transmission of signals across a neuromuscular junction, which of the following happens last?
    9·1 answer
  • All of the following statements referring to the uterine cycle are true EXCEPT ________. A) FSH and LH directly promote developm
    8·1 answer
  • Explain how reflex action takes place ​
    9·1 answer
  • During an action potential, the movement of sodium ions into a neuron causes the neuronal membrane to do which of the following?
    12·1 answer
  • What type of diagram shows how energy moves in a eycosystem
    10·1 answer
  • What is a specialized species
    8·1 answer
  • The electrons are not shared equally creating a _________ molecule.
    13·1 answer
  • Please help me. I been stuck on this question for a long time :(​
    10·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!