1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Keith_Richards [23]
3 years ago
10

What do you expect will happen to the water

Biology
2 answers:
MrRa [10]3 years ago
8 0

Answer:

they will move into the cell

andrezito [222]3 years ago
7 0

Anser:

b. they will move into the cell.

Explanation:

just got it correct

You might be interested in
Which is the first type of cell to differentiate?
Allisa [31]
<span>Which is the first type of cell to differentiate?

<span>Answer:</span></span>
D. blood cell
5 0
3 years ago
Na + Cl2 --&gt; NaCl if you were given 15 grams of sodium (with excess chlorine) and asked to determine the amount of NaCl that
Elena-2011 [213]

Answer:

The correct answer is - 38.15 gm of NaCl.

Explanation:

Write the balanced equation for this reaction of sodium (Na) and chlorine (Cl₂) to produce sodium chloride (NaCl):

2Na + Cl₂ —> 2NaCl

the mass of Na and the mass of NaCl :

Molar mass of Na = 23 g/mol

In the balanced equation = 2 × 23 = 46 g

Molar mass of NaCl = 23 + 35.5

= 58.5 g/mol

similarly in balanced equation = 2 × 58.5 = 117 g

From the balanced equation above,

46 g of Na reacted to produce 117 g of NaCl.

By converting it to 15 grams of Na.

Therefore,15 g of Na will react to produce = (15 × 117)/46 = 38.15 g of NaCl.

Thus, 38.15 g of Na

4 0
3 years ago
How are the plants in a desert ecosystem most likely to differ from the plants in a rain forest ecosystem?
erik [133]
Hey,

I believe this answer is A: The desert plants are likely to be better at retaining water.

Which they do, and they have to cause water is very scarce in the desert unlike the rain forest.

Desert plants likely to be larger is not proven and most plants can vary in size.

Narrower stems may have something to do with it but that goes back to they have to hold more water so this is incorrect.

Brighter flowers doesn't have anything to do with water consumption within a plant so this is incorrect as well.

Hope this helps!
Brainliest is always appreciated if you feel its deserved.
 <span />
5 0
3 years ago
Read 2 more answers
A person is standing with a drawn bow and arrow. He is aiming it at a bull's-eye. What type of energy is being described?
Leya [2.2K]
The energy being described is potential energy.
8 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Other questions:
  • Taconite is a low-grade iron ore that is found around Lake Superior. The iron-bearing rock is found interlaced with quartz, cher
    15·2 answers
  • There are 25 elements found in living things. How many of these elements are found in some organisms but not all?
    8·1 answer
  • A population is growing at a rate of 2, 4, 8, 16, 32. Which type of growth does this describe?
    6·1 answer
  • What kind of molecules that allows glucose molecules to pass through?
    8·1 answer
  • Which type of strength training uses machine-generated forces to increase muscle strength and endurance? A. bench pressing B. po
    9·2 answers
  • True or False we can understand why we see natural resources like copper and gold where they are because we understand under whi
    11·1 answer
  • HELP ASAP I WILL GIVE BRAINLIST
    7·1 answer
  • Did humans and dinosaurs coexist ? Explain your response
    13·1 answer
  • When scientist copy DNA dean first have to cut out the part thing want to copy what molecule do they use to do this
    14·1 answer
  • A dinoflagellate is a microscopic organism that is very common in the ocean. It consists of a single cell and has a flagella tha
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!