1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sashaice [31]
3 years ago
5

Which gland of the endocrine system is located near the stomach and is responsible for producing enzymes and hormones that help

with digestion?
Biology
2 answers:
aliya0001 [1]3 years ago
8 0
I believe the gland is the pancreas!
puteri [66]3 years ago
6 0

Answer:

the gland is pancreas

Explanation:

You might be interested in
How can bacteria become drug resistant and how that impacts humans and healthcare ? ⚠️!worth 30 points!⚠️ helppp
Cerrena [4.2K]

Answer:

Antibiotic resistance occurs when bacteria change in response to the use of these medicines. Bacteria, not humans or animals, become antibiotic-resistant. These bacteria may infect humans and animals, and the infections they cause are harder to treat than those caused by non-resistant bacteria

Explanation:

hope this helps :)

5 0
3 years ago
Match each description to the appropriate biome
Stella [2.4K]

Answer:

desert

taiga

tropical savanna

tundra

tropical  rainforest

Explanation:

5 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Explain why the number of red and yellow kernels on the ear of corn represents the results of cross that is observed
Grace [21]

Answer:

The red kernels are the dominant trait and will be more numerous on the ear of corn than the yellow. This happens because its dominance mearns that if it is a combination of either RR or Rr, it will still take over the r trait. The only time the yellow can be expressed entirely Is when the combination is rr.

3 0
3 years ago
deforestation the chopping down of large numbers trees for human use is considered to have a negative impact on climate change.
Rudiy27

Answer:

Plants take in carbon dioxide from the environment for photosynthesis. Because trees are large, they need a lot of energy, which likely results in a lot of carbon dioxide being removed from the air. If they’re chopped down, there will be fewer trees to remove the extra carbon dioxide from the air.

Explanation:

answer from Plato

6 0
3 years ago
Read 2 more answers
Other questions:
  • Which is NOT true of eukaryotic cells?
    9·1 answer
  • Miles wants to write the equation for photosynthesis. The diagram below represents one of the molecules in the equation.
    7·1 answer
  • Which of the following can occur when the<br> moon is at location 1?
    8·2 answers
  • Viruses are different from bacteria in that
    7·2 answers
  • In living cells, what is the energy carrier that fuels most kinds of cellular work? glucose ATP ADP
    7·1 answer
  • What’s climate change
    11·1 answer
  • Please help me ! I have a testtt
    7·2 answers
  • Every time the blood enters the heart how many chambers must it go through before it leaves to go to the lungs OR the body?
    6·1 answer
  • Which of these is NOT a reason for mitosis in humans?
    8·2 answers
  • In translation What are are the three letters called in mRNA and what are they connected to ??
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!