1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wariber [46]
3 years ago
5

When you throw a ball the motion of the ball is an example of

Biology
2 answers:
ivolga24 [154]3 years ago
8 0
Mechanical energy is the answer

erastova [34]3 years ago
8 0
Its mechanical energy

You might be interested in
An ecosystem is defined as
kirill115 [55]

Answer:

An Ecosystem is a community of Living Organisms and Non living components of their Environment

OPTION A IS YOUR ANSWER!!!

4 0
3 years ago
Read 2 more answers
A rapid mechanism is thought to govern the localization of AQP5 in response to changes in extracellular osmolarity. If this mech
777dan777 [17]

Answer:

(B) HEK cells exposed to the most hypotonic conditions will display the greatest degree of AQP5 membrane localization, allowing water to flow into the cells.

Explanation:

The function of AQP5 (an aquaporin) is to allow the water to move into or out of the cell down the concentration gradient. When placed in hypotonic solutions, the internal environment of HEK cells will be hypertonic. Water always moves from hypotonic (higher water concentration) to hypertonic (lower water concentration) solution.  

Hence, the HEK cells exposed to the hypotonic conditions will localize AQP5 in their membranes to allow the water to move from out hypotonic conditions to the inner hypertonic environment.  

7 0
3 years ago
What similaririties does nuclear and chemical energy have in common
Solnce55 [7]
Both are types of potential energy

both involve stored energy
7 0
3 years ago
Rachael wants to test how sunlight impacts plant growth over time. She will add varying amounts of light to different sets of pl
Mrrafil [7]

Answer:

Independent variable: varying amounts of light

Dependent variable: plant growth

Explanation:

The variable, which are factors that can be altered, in an experiment can either be independent or dependent. An independent variable is one in which the experimenter manipulates or controls in order to bring about an outcome. For this experiment conducted by Rachel, the independent variable is the VARYING AMOUNT OF LIGHTS.

The dependent variable is the variable that responds to changes of the independent variable. In other words, the dependent variable is the outcome of manipulating the independent variable. Hence, the dependent variable is dependent on the independent variable. For Rachel's experiment, the PLANT GROWTH is the dependent variable because it is what responds to changes in amount of light (independent variable).

4 0
3 years ago
What are the similarities between the pulmonary and systemic circuits
defon

Answer:

Pulmonary circulation moves blood between the heart and the lungs. It transports deoxygenated blood to the lungs to absorb oxygen and release carbon dioxide. The oxygenated blood then flows back to the heart. Systemic circulation moves blood between the heart and the rest of the body.

Explanation:

6 0
3 years ago
Other questions:
  • Joe was observing an embryo with 16 cells.what is a 16-celled enbryo called?
    6·1 answer
  • Which of these statements is true concerning the usda animal welfare act?
    10·1 answer
  • Determine which of the following characteristics are environmental, not inherited.
    8·1 answer
  • What macromolecules are capable of self-replication?
    14·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Identify the type of symbiosis described.
    9·2 answers
  • _____ is the process by which indivuduals that are better adapted to their environment are more likely to survive and reproduce
    8·1 answer
  • The product of ________<br> is a zygote and an endosperm.
    13·1 answer
  • Two of the body's organ systems work together to provide oxygen to the cells. How do the systems work together to do this?
    13·1 answer
  • You need to start an experiment and the instructions are to mix 2 g of sodium bicarbonate with 50 ml of distilled water and then
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!