1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xxMikexx [17]
3 years ago
11

Mya is running a marathon. Her heartbeat increases. How does the increase in heartbeats assist Mya’s respiratory system? The inc

rease of blood through her body allows for more oxygen to be delivered to her tissues. The increase of blood through her body allows for less oxygen to be delivered to her tissues. The increase of blood through her body allows for more carbon dioxide to be delivered to her tissues. The increase of blood through her body allows for less carbon dioxide to be delivered to her tissues.b
Biology
2 answers:
Stolb23 [73]3 years ago
6 0

the increase of blood through her body allows for more oxygen

kvasek [131]3 years ago
4 0

Answer:

the answer is a

Explanation:

You might be interested in
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
You are studying body color in an African spider and have found that it is controlled by a single gene with four alleles: B (bro
lisabon 2012 [21]

Answer:

<h2>50% are brown.</h2><h2>50% are green.</h2><h2 />

Explanation:

Given;

B allele is for brown color, so B = brown,

br= red,

bg= green,

by= yellow.

B is dominant over all;

bg is dominant over by;

br is dominant over bg;

by is recessive to all other alleles.

Here,  cross between  brown (B/by) and pure green (bg/bg).

B/by× bg/bg

progeny

Genotype= B/bg, B/bg, by/bg and by/bg.

Phenotype= B/bg= brown;

by/bg= green

So, 1/2 are brown and 1/2 are green.

5 0
3 years ago
Which statement is a logical inference based on details in the passage? Imported marmalade was available year-round. Imported ma
Arisa [49]

Answer:

Imported marmalade was expensive.

Explanation:

5 0
3 years ago
If one organism was removed from the ecosystem what would happen to the ecosystem
Maslowich
It would have a decrease in the numbers of animals because the food chain would be thrown off
6 0
3 years ago
why Repeat your investigation 3 times? Why is it important to repeat the steps of data collection in biology?
Xelga [282]

Answer:

to get a Repeating answer so you know the first time wasn't a fluke

Explanation:

7 0
3 years ago
Other questions:
  • Exocytosis is the process by which vesicles in the cytoplasm fuse with the cell membrane, releasing their contents into the cell
    14·1 answer
  • An increase in temperature affects the reaction rate by decreasing the velocities of particles that collide in the reaction. inc
    6·2 answers
  • this image shows objects trailing behind a fishing boat. how does the method reduce the amount of bird by catch by fishing boats
    6·1 answer
  • Cellular respiration extracts energy from what molecule?
    10·1 answer
  • How will a seedling grow if it receives no light?
    8·1 answer
  • Which flow chart best summarizes the process of protein synthesis?
    14·1 answer
  • If the biodiversity of an ecosystem is increased, the ecosystem will become __________.
    9·1 answer
  • What cause disease blood cancer
    8·2 answers
  • 9. When water is ejected from the earth's interior in the form of hot water, it is called
    13·1 answer
  • What directs cell activities
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!