1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mrs_skeptik [129]
3 years ago
5

The beginning of the Cretaceous period is marked by the emergence of dinosaurs in the fossil record.

Biology
2 answers:
GalinKa [24]3 years ago
7 0
<span> The beginning of the Cretaceous period is marked by the emergence of dinosaurs in the fossil record. FALSE</span>
Dmitry_Shevchenko [17]3 years ago
4 0
I think the answer is true
You might be interested in
Which of the following affects the speed of a planet's revolution?
castortr0y [4]
I would say B) because the rest dosnt quite make sense to me and A) the  gravity of the sun would still be the same despite the shape if we have an triangle block and  an sphere then drop the they are going to drop at the same speed the gravity is not going to sphere is not going to fall faster 
8 0
3 years ago
Read 2 more answers
Certain poisons are toxic to organisms because they interfere with the function of enzymes in mictochondria. This results direct
Svetllana [295]
Produce ATP, a necessary energy source
6 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
What information does the first sentence convey the reader
guajiro [1.7K]

It provides the reader with your topic and give them a central idea of your writing.

5 0
3 years ago
PLEASE HELP! I need an answer ASAP!
11111nata11111 [884]

Gravity , Explosion

<u>Explanation:</u>

Nebulae are made of dust and gases—mostly hydrogen and helium. The dust and gases in a nebula are very spread out, but gravity can slowly begin to pull together clumps of dust and gas. As these clumps get bigger and bigger, their gravity gets stronger and stronger.

Eventually, the clump of dust and gas gets so big that it collapses from its own gravity. The collapse causes the material at the center of the cloud to heat up-and this hot core is the beginning of a star.

7 0
3 years ago
Read 2 more answers
Other questions:
  • Biology chapter 7 answer test
    9·1 answer
  • The human genome has<br> number of base pairs <br> Answer
    8·1 answer
  • How is this person able to stay on the skateboard
    5·2 answers
  • Specialized vacuole that pinches off golgi and delivers macromolecules
    8·1 answer
  • If you ate a hamburger, you would probably only get about _____ of the original energy from the sun.
    11·2 answers
  • Assad and Juana believe in stimulating their new baby’s senses by playing and singing to her. They also believe it is important
    7·1 answer
  • A scientist uses a camera to study the stars.
    5·1 answer
  • The selectively permeable membrane is permeable to which types of solute molecules
    8·1 answer
  • You guys HELP i’m fr abt to just give up
    5·1 answer
  • Explain Daniel 1:8 please​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!